pQE- 30 Xa Plasmid


  • Model: PVT0522
  • 50 Units in Stock
Ask a question

Add to Cart:

pQE-30 Xa

Search name

pQE-30 Xa,Plasmid pQE-30 Xa,pQE-30 Xa vector



pQE-30 Xa Information

Promoter: T5

Replicon: ColE1 ori

Terminator: lambda t0 Terminator

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pQE series plasmid.

Plasmid size: 3509bp

Plasmid tagging: N-6 x His, N- Factor Xa site

Prokaryotic resistance: ampicillin Amp (100 g/ml)

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic, LB

Expression host: M15

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: pQE30-F (TGAGCGGATAACAATTTCAC)

3'sequencing primers: pQE-R (GTTCTGAGGTCATTACTGG)


pQE-30 Xa Description

The pQE-30Xa plasmid contains a powerful T5 promoter (identified by E.coli RNA polymerase) and two lac operon suppression modules, which are used to regulate and express fusion proteins at high level in E.coli. In the presence of Lac inhibitors at high levels, protein synthesis was effectively blocked, and the stability of cytotoxin vector was enhanced. The pQE vector could carry 6 X His tags on the N or C ends of the recombinant protein.


pQE-30 Xa  Multiple cloning site



pQE-30 Xa  Sequence

LOCUS       Exported                3509 bp ds-DNA     circular SYN 09-JAN-2013
DEFINITION  Bacterial vector for expressing N-terminally 6xHis-tagged proteins
            with a Factor Xa cleavage site.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3509)
  AUTHORS   Qiagen
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 8, 2016 from SnapGene Viewer 3.1.4
COMMENT     Clone at StuI to insert a coding sequence just after the Factor Xa
            cleavage site.
FEATURES             Location/Qualifiers
     source          1..3509
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             101..106
                     /note="ribosome binding site"
     CDS             115..117
                     /product="start codon"
     CDS             127..144
                     /product="6xHis affinity tag"
     CDS             166..177
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     misc_feature    175..240
                     /note="multiple cloning site"
     misc_feature    240..250
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     terminator      256..350
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             394..1053
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1118..1204
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     rep_origin      complement(1685..2273)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2444..3304)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3305..3409)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
