pQE- 31 Plasmid


  • Model: PVT0523
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0523  2ug


pQE-31 Information

Replicon: Ori

Terminator: Lambda t0

Plasmid classification: Escherichia coli vector; pQE series expression plasmid.

Plasmid size: 3463bp

Plasmid label: N-His

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: M15

Culture conditions: 37 centigrade, aerobic, LB

Induction mode: no induction

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE-31 Description



pQE-31 Sequence

LOCUS       Exported                3463 bp ds-DNA     circular SYN 08-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3463)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 8, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3463
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             97..108
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             127..144
                     /product="6xHis affinity tag"
     terminator      210..304
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             348..1007
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1072..1158
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     misc_feature    1313..1453
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(1639..2227)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2398..3258)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3259..3363)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatctcacc atcaccatca ccatacggat ccgcatgcga gctcggtacc ccgggtcgac
      181 ctgcagccaa gcttaattag ctgagcttgg actcctgttg atagatccag taatgacctc
      241 agaactccat ctggatttgt tcagaacgct cggttgccgc cgggcgtttt ttattggtga
      301 gaatccaagc tagcttggcg agattttcag gagctaagga agctaaaatg gagaaaaaaa
      361 tcactggata taccaccgtt gatatatccc aatggcatcg taaagaacat tttgaggcat
      421 ttcagtcagt tgctcaatgt acctataacc agaccgttca gctggatatt acggcctttt
      481 taaagaccgt aaagaaaaat aagcacaagt tttatccggc ctttattcac attcttgccc
      541 gcctgatgaa tgctcatccg gaatttcgta tggcaatgaa agacggtgag ctggtgatat
      601 gggatagtgt tcacccttgt tacaccgttt tccatgagca aactgaaacg ttttcatcgc
      661 tctggagtga ataccacgac gatttccggc agtttctaca catatattcg caagatgtgg
      721 cgtgttacgg tgaaaacctg gcctatttcc ctaaagggtt tattgagaat atgtttttcg
      781 tctcagccaa tccctgggtg agtttcacca gttttgattt aaacgtggcc aatatggaca
      841 acttcttcgc ccccgttttc accatgggca aatattatac gcaaggcgac aaggtgctga
      901 tgccgctggc gattcaggtt catcatgccg tttgtgatgg cttccatgtc ggcagaatgc
      961 ttaatgaatt acaacagtac tgcgatgagt ggcagggcgg ggcgtaattt ttttaaggca
     1021 gttattggtg cccttaaacg cctggggtaa tgactctcta gcttgaggca tcaaataaaa
     1081 cgaaaggctc agtcgaaaga ctgggccttt cgttttatct gttgtttgtc ggtgaacgct
     1141 ctcctgagta ggacaaatcc gccctctaga gctgcctcgc gcgtttcggt gatgacggtg
     1201 aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg
     1261 ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca
     1321 tgacccagtc acgtagcgat agcggagtgt atactggctt aactatgcgg catcagagca
     1381 gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg taaggagaaa
     1441 ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg
     1501 gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg
     1561 ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa
     1621 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg
     1681 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc
     1741 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc
     1801 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc
     1861 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg
     1921 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc
     1981 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga
     2041 gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc
     2101 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac
     2161 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg
     2221 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc
     2281 acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa
     2341 ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta
     2401 ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt
     2461 tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag
     2521 tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca
     2581 gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc
     2641 tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt
     2701 tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag
     2761 ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt
     2821 tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat
     2881 ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt
     2941 gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc
     3001 ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat
     3061 cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag
     3121 ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt
     3181 ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg
     3241 gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta
     3301 ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc
     3361 gcgcacattt ccccgaaaag tgccacctga cgtctaagaa accattatta tcatgacatt
     3421 aacctataaa aataggcgta tcacgaggcc ctttcgtctt cac



Product is for research use only!

Search name

pQE-31,Plasmid pQE-31,pQE-31 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
