pQE- 40 Plasmid


  • Model: PVT0525
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-40,Plasmid pQE-40,pQE-40 vector


pQE- 40 Information

Replicon: Ori

Terminator: Lambda t0

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 4031bp

Plasmid label: N-His

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: M15

Culture conditions: 37 centigrade, aerobic, LB

Induction mode: no induction

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE- 40 Description



pQE- 40 Sequence

LOCUS       Exported                4031 bp ds-DNA     circular SYN 08-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4031)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 8, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers
     source          1..4031
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             97..108
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             127..144
                     /product="6xHis affinity tag"
     CDS             157..714
                     /gene="Mus musculus Dhfr"
                     /product="mouse dihydrofolate reductase"
     terminator      778..872
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             916..1575
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1640..1726
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     misc_feature    1881..2021
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(2207..2795)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2966..3826)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3827..3931)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatcgcatc accatcacca tcacggatcc ggcatcatgg ttcgaccatt gaactcgatc
      181 gtcgccgtgt cccaaaatat ggggattggc aagaacggag acctaccctg gcctccgctc
      241 aggaacgagt tcaagtactt ccaaagaatg accacaacct cttcagtgga aggtaaacag
      301 aatctggtga ttatgggtag gaaaacctgg ttctccattc ctgagaagaa tcgaccttta
      361 aaggacagaa ttaatatagt tctcagtaga gaactcaaag aaccaccacg aggagctcat
      421 tttcttgcca aaagtttgga tgatgcctta agacttattg aacaaccgga attggcaagt
      481 aaagtagaca tggtttggat agtcggaggc agttctgttt accaggaagc catgaatcaa
      541 ccaggccacc ttagactctt tgtgacaagg atcatgcagg aatttgaaag tgacacgttt
      601 ttcccagaaa ttgatttggg gaaatataaa cttctcccag aatacccagg cgtcctctct
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
