pQE- 41 Plasmid


  • Model: PVT0526
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-41,Plasmid pQE-41,pQE-41 vector


pQE-41 Information

Promoter: T5

Replicon: ColE1 ori

Terminator: Lambda t0 terminator; rrnB T1

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 4031bp

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: M15

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC



pQE-41 Description




pQE-41 Sequence

LOCUS       Exported                4031 bp ds-DNA     circular SYN 05-DEC-2013
DEFINITION  Bacterial vector for expressing DHFR fusion proteins with an
            N-terminal 6xHis tag. For other reading frames, use pQE-40 or
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4031)
  AUTHORS   Qiagen
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.1.4
COMMENT     Discontinued pQE vector.
FEATURES             Location/Qualifiers
     source          1..4031
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             101..106
                     /note="ribosome binding site"
     CDS             115..117
                     /product="start codon"
     CDS             127..144
                     /product="6xHis affinity tag"
     CDS             157..714
                     /gene="Mus musculus Dhfr"
                     /product="mouse dihydrofolate reductase"
     misc_feature    720..761
                     /note="multiple cloning site"
     misc_feature    761..771
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     terminator      777..871
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             915..1574
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1639..1725
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     rep_origin      complement(2207..2795)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2966..3826)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
