pQE- 50 Plasmid


  • Model: PVT0528
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-50,Plasmid pQE-50,pQE-50 vector

pQE- 50 Plasmid information

Promoter: T5
Replicon: ColE1 ori
Terminator: Lambda t0 terminator; rrnB T1
Plasmid classification: Escherichia coli vector; pQE series expression plasmid
Plasmid size: 3438bp
Prokaryotic resistance: ampicillin Amp
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expression host: M15
Culture conditions: 37, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: pQE30-F: AGCGGATAACAATTTCACACAG
Primers for 3'sequencing: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE- 50 Plasmid  Sequence

LOCUS       Exported                3438 bp ds-DNA     circular SYN 05-DEC-2013
DEFINITION  Bacterial vector for expressing untagged proteins. For other reading
            frames, use pQE-51 or pQE-52.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3438)
  AUTHORS   Qiagen
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.1.4
COMMENT     Discontinued pQE vector.
FEATURES             Location/Qualifiers
     source          1..3438
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             101..106
                     /note="ribosome binding site"
     CDS             115..117
                     /product="start codon"
     misc_feature    121..168
                     /note="multiple cloning site"
     misc_feature    168..178
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     terminator      184..278
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             322..981
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1046..1132
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     rep_origin      complement(1614..2202)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2373..3233)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3234..3338)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatccgcat gcgagctcgg taccccgggt cgacctgcag ccaagcttaa ttagctgagc
      181 ttggactcct gttgatagat ccagtaatga cctcagaact ccatctggat ttgttcagaa
      241 cgctcggttg ccgccgggcg ttttttattg gtgagaatcc aagctagctt ggcgagattt
      301 tcaggagcta aggaagctaa aatggagaaa aaaatcactg gatataccac cgttgatata
      361 tcccaatggc atcgtaaaga acattttgag gcatttcagt cagttgctca atgtacctat
      421 aaccagaccg ttcagctgga tattacggcc tttttaaaga ccgtaaagaa aaataagcac
      481 aagttttatc cggcctttat tcacattctt gcccgcctga tgaatgctca tccggaattt
      541 cgtatggcaa tgaaagacgg tgagctggtg atatgggata gtgttcaccc ttgttacacc
      601 gttttccatg agcaaactga

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
