pQE- 70


  • Model: PVT0532
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0532      2ug

pQE-70 Information

Replicon: Ori

Terminator: Lambda t0

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 3426bp

Plasmid tagging: C-His

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: M15

Culture conditions: 37 C, aerobic, LB

Induction mode: no need to induce

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE-70 Multiple cloning site



pQE-70 Sequence

LOCUS       Exported                3426 bp ds-DNA     circular SYN 08-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3426)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 8, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3426
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             97..108
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             133..150
                     /product="6xHis affinity tag"
     terminator      173..267
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             311..970
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1035..1121
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     misc_feature    1276..1416
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(1602..2190)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2361..3221)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3222..3326)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aagcatgcga
      121 ggatccagat ctcatcacca tcaccatcac taagcttaat tagctgagct tggactcctg
      181 ttgatagatc cagtaatgac ctcagaactc catctggatt tgttcagaac gctcggttgc
      241 cgccgggcgt tttttattgg tgagaatcca agctagcttg gcgagatttt caggagctaa
      301 ggaagctaaa atggagaaaa aaatcactgg atataccacc gttgatatat cccaatggca
      361 tcgtaaagaa cattttgagg catttcagtc agttgctcaa tgtacctata accagaccgt
      421 tcagctggat attacggcct ttttaaagac cgtaaagaaa aataagcaca agttttatcc
      481 ggcctttatt cacattcttg cccgcctgat gaatgctcat ccggaatttc gtatggcaat
      541 gaaagacggt gagctggtga tatgggatag tgttcaccct tgttacaccg ttttccatga
      601 gcaaactgaa acgttttcat cgctctggag tgaataccac gacgatttcc ggcagtttct
      661 acacatatat tcgcaagatg tggcgtgtta cggtgaaaac ctggcctatt tccctaaagg
      721 gtttattgag aatatgtttt tcgtctcagc caatccctgg gtgagtttca ccagttttga
      781 tttaaacgtg gccaatatgg acaacttctt cgcccccgtt ttcaccatgg gcaaatatta
      841 tacgcaaggc gacaaggtgc tgatgccgct ggcgattcag gttcatcatg ccgtttgtga
      901 tggcttccat gtcggcagaa tgcttaatga attacaacag tactgcgatg agtggcaggg
      961 cggggcgtaa tttttttaag gcagttattg gtgcccttaa acgcctgggg taatgactct
     1021 ctagcttgag gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta
     1081 tctgttgttt gtcggtgaac gctctcctga gtaggacaaa tccgccctct agagctgcct
     1141 cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac
     1201 agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt
     1261 tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg
     1321 cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata
     1381 ccgcacagat gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact
     1441 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta
     1501 atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag
     1561 caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc
     1621 cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta
     1681 taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg
     1741 ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc
     1801 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac
     1861 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac
     1921 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg
     1981 aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga
     2041 aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt
     2101 agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag
     2161 cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct
     2221 gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg
     2281 atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat
     2341 gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc
     2401 tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg
     2461 gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct
     2521 ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca
     2581 actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg
     2641 ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg
     2701 tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc
     2761 cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag
     2821 ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg
     2881 ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag
     2941 tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat
     3001 agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg
     3061 atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca
     3121 gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca
     3181 aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat
     3241 tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag
     3301 aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa
     3361 gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt
     3421 cttcac


Product is for research use only!


Search name

pQE-70,Plasmid pQE-70,pQE-70 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
