pQE- 8 Plasmid


  • Model: PVT0506
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-8,Plasmid pQE-8,pQE-8 vector


pQE-8 Informaiton

Promoter: T5

Replicon: ColE1 ori

Terminator: Lambda t0 terminator; rrnB T1

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 3427bp

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: M15

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE-8 Description




pQE-8 Sequence

LOCUS       Exported                3427 bp ds-DNA     circular SYN 09-JAN-2013
DEFINITION  Bacterial vector for expressing N-terminally 6xHis-tagged proteins.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3427)
  AUTHORS   Qiagen
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.1.4
COMMENT     Discontinued pQE vector.
FEATURES             Location/Qualifiers
     source          1..3427
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             101..106
                     /note="ribosome binding site"
     CDS             115..117
                     /product="start codon"
     CDS             127..144
                     /product="6xHis affinity tag"
     misc_feature    151..167
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     terminator      173..267
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             311..970
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1035..1121
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     rep_origin      complement(1603..2191)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2362..3222)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3223..3327)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatcgcatc accatcacca tcacggatcc taagcttaat tagctgagct tggactcctg
      181 ttgatagatc cagtaatgac ctcagaactc catctggatt tgttcagaac gctcggttgc
      241 cgccgggcgt tttttattgg tgagaatcca agctagcttg gcgagatttt caggagctaa
      301 ggaagctaaa atggagaaaa aaatcactgg atataccacc gttgatatat cccaatggca
      361 tcgtaaagaa cattttgagg catttcagtc agttgctcaa tgtacctata accagaccgt
      421 tcagctggat attacggcct ttttaaagac cgtaaagaaa aataagcaca agttttatcc
      481 ggcctttatt cacattcttg cccgcctgat gaatgctcat ccggaatttc gtatggcaat
      541 gaaagacggt gagctggtga tatgggatag tgttcaccct tgttacaccg ttttccatga
      601 gcaaactgaa acgttttcat cgctctggag tgaataccac gacgatttcc ggcagtttct
      661 acacatatat tcgcaagatg tggcgtgtta cggtgaaaac ctggcctatt tccctaaagg
      721 gtttattgag aatatgtttt tcgtctcagc caatccctgg gtgagtttca ccagttttga
      781 tttaaacgtg gccaatatgg acaacttctt cgcccccgtt ttcaccatgg gcaaatatta
      841 tacgcaaggc gacaaggtgc tgatgccgct ggcgattcag gttcatcatg ccgtctgtga
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
