pQE- 80L


  • Model: PVT0534
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0534     2ug

pQE-80L Information

Replicon: Ori
Terminator: Lambda t0
Plasmid classification: Escherichia coli vector; pQE series expression plasmid
Plasmid size: 4751bp
Plasmid Tags: 6*His
Prokaryotic resistance: ampicillin Amp
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expression host: M15
Culture conditions: 37, aerobic, LB
Induction method: no need to induce
Primers for 5'sequencing: pQE30-F: AGCGGATAACAATTTCACACAG
Primers for 3'sequencing: pQE30-R: TTCTGAGGTCATTACTGGATC

pQE-80L Description

pQE-80L is a protein expression plasmid of Escherichia coli.

pQE-80L plasmid

pQE-80L Sequence

LOCUS       Exported File           4751 bp ds-DNA    circular SYN 01-2-2015
KEYWORDS    Untitled 4
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4751)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-2-1 
FEATURES             Location/Qualifiers
     source          1..4751
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             127..144
                     /product="6xHis affinity tag"
     terminator      208..302
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             346..1005
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1070..1156
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     CDS             complement(1249..2331)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2332..2409)
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     misc_feature    2601..2741
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(2927..3515)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3686..4546)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4547..4651)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatcgcatc accatcacca tcacggatcc gcatgcgagc tcggtacccc gggtcgacct
      181 gcagccaagc ttaattagct gagcttggac tcctgttgat agatccagta atgacctcag
      241 aactccatct ggatttgttc agaacgctcg gttgccgccg ggcgtttttt attggtgaga
      301 atccaagcta gcttggcgag attttcagga gctaaggaag ctaaaatgga gaaaaaaatc
      361 actggatata ccaccgttga tatatcccaa tggcatcgta aagaacattt tgaggcattt
      421 cagtcagttg ctcaatgtac ctataaccag accgttcagc tggatattac ggccttttta
      481 aagaccgtaa agaaaaataa gcacaagttt tatccggcct ttattcacat tcttgcccgc
      541 ctgatgaatg ctcatccgga atttcgtatg gcaatgaaag acggtgagct ggtgatatgg
      601 gatagtgttc acccttgtta caccgttttc catgagcaaa ctgaaacgtt ttcatcgctc
      661 tggagtgaat accacgacga tttccggcag tttctacaca tatattcgca agatgtggcg
      721 tgttacggtg aaaacctggc ctatttccct aaagggttta ttgagaatat gtttttcgtc
      781 tcagccaatc cctgggtgag tttcaccagt tttgatttaa acgtggccaa tatggacaac
      841 ttcttcgccc ccgttttcac catgggcaaa tattatacgc aaggcgacaa ggtgctgatg
      901 ccgctggcga ttcaggttca tcatgccgtt tgtgatggct tccatgtcgg cagaatgctt
      961 aatgaattac aacagtactg cgatgagtgg cagggcgggg cgtaattttt ttaaggcagt
     1021 tattggtgcc cttaaacgcc tggggtaatg actctctagc ttgaggcatc aaataaaacg
     1081 aaaggctcag tcgaaagact gggcctttcg ttttatctgt tgtttgtcgg tgaacgctct
     1141 cctgagtagg acaaatccgc cctctagatt acgtgcagtc gatgataagc tgtcaaacat
     1201 gagaattgtg cctaatgagt gagctaactt acattaattg cgttgcgctc actgcccgct
     1261 ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga
     1321 ggcggtttgc gtattgggcg ccagggtggt ttttcttttc accagtgaga cgggcaacag
     1381 ctgattgccc ttcaccgcct ggccctgaga gagttgcagc aagcggtcca cgctggtttg
     1441 ccccagcagg cgaaaatcct gtttgatggt ggttaacggc gggatataac atgagctgtc
     1501 ttcggtatcg tcgtatccca ctaccgagat atccgcacca acgcgcagcc cggactcggt
     1561 aatggcgcgc attgcgccca gcgccatctg atcgttggca accagcatcg cagtgggaac
     1621 gatgccctca ttcagcattt gcatggtttg ttgaaaaccg gacatggcac tccagtcgcc
     1681 ttcccgttcc gctatcggct gaatttgatt gcgagtgaga tatttatgcc agccagccag
     1741 acgcagacgc gccgagacag aacttaatgg gcccgctaac agcgcgattt gctggtgacc
     1801 caatgcgacc agatgctcca cgcccagtcg cgtaccgtct tcatgggaga aaataatact
     1861 gttgatgggt gtctggtcag agacatcaag aaataacgcc ggaacattag tgcaggcagc
     1921 ttccacagca atggcatcct ggtcatccag cggatagtta atgatcagcc cactgacgcg
     1981 ttgcgcgaga agattgtgca ccgccgcttt acaggcttcg acgccgcttc gttctaccat
     2041 cgacaccacc acgctggcac ccagttgatc ggcgcgagat ttaatcgccg cgacaatttg
     2101 cgacggcgcg tgcagggcca gactggaggt ggcaacgcca atcagcaacg actgtttgcc
     2161 cgccagttgt tgtgccacgc ggttgggaat gtaattcagc tccgccatcg ccgcttccac
     2221 tttttcccgc gttttcgcag aaacgtggct ggcctggttc accacgcggg aaacggtctg
     2281 ataagagaca ccggcatact ctgcgacatc gtataacgtt actggtttca cattcaccac
     2341 cctgaattga ctctcttccg ggcgctatca tgccataccg cgaaaggttt tgcaccattc
     2401 gatggtgtcg gaatttcggg cagcgttggg tcctggccac gggtgcgcat gatctagagc
     2461 tgcctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct cccggagacg
     2521 gtcacagctt gtctgtaagc ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg
     2581 ggtgttggcg ggtgtcgggg cgcagccatg acccagtcac gtagcgatag cggagtgtat
     2641 actggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat atgcggtgtg
     2701 aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc
     2761 tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg
     2821 cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag
     2881 gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
     2941 gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag
     3001 gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga
     3061 ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc
     3121 atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
     3181 tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt
     3241 ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca
     3301 gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca
     3361 ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag
     3421 ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca
     3481 agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
     3541 ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa
     3601 aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta
     3661 tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag
     3721 cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga
     3781 tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac
     3841 cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc
     3901 ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta
     3961 gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac
     4021 gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
     4081 gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa
     4141 gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg
     4201 tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag
     4261 aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc
     4321 cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct
     4381 caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat
     4441 cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg
     4501 ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc
     4561 aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta
     4621 tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg
     4681 tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct
     4741 ttcgtcttca c

Product is for research use only!


Search name

pQE-80L,Plasmid pQE-80L,pQE-80L vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
