pQE- 81L- Kanamycin Plasmid


  • Model: PVT0537
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-81L-Kanamycin,Plasmid pQE-81L-Kanamycin,pQE-81L-Kanamycin vector



pQE-81L-Kanamycin Information

Promoter: T5

Replicon: ColE1 ori

Terminator: Lambda t0 terminator; rrnB T1

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 4543bp

Prokaryotic resistance: kanamycin Kan

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: M15

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE-81L-Kanamycin Multiple cloning site




pQE-81L-Kanamycin Sequence

LOCUS       Exported                4543 bp ds-DNA     circular SYN 05-DEC-2013
DEFINITION  Bacterial lacIq vector with a kanamycin resistance marker for
            expressing N-terminally 6xHis-tagged proteins. For other reading
            frames, use pQE-80L-Kan or pQE-82L-Kan.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4543)
  AUTHORS   Qiagen
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.1.4
COMMENT     Because this vector contains the lacIq gene, the pREP4 plasmid is
            not needed.
FEATURES             Location/Qualifiers
     source          1..4543
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             101..106
                     /note="ribosome binding site"
     CDS             115..117
                     /product="start codon"
     CDS             127..144
                     /product="6xHis affinity tag"
     misc_feature    147..194
                     /note="multiple cloning site"
     misc_feature    194..204
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     terminator      210..304
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             348..1007
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1072..1158
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     CDS             complement(1251..2333)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2334..2411)
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     rep_origin      complement(2929..3517)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3624..4439)

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
