pQE- 82L Plasmid


  • Model: PVT0538
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-82L,Plasmid pQE-82L,pQE-82L vector


pQE-82L Information

Promoter: T5

Replicon: Ori

Terminator: Lambda t0

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 4752bp

Plasmid tagging: N-His

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: M15

Culture conditions: 37 C, aerobic, LB

Induction mode: no need to induce

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE-82L Multiple cloning site

pQE-82L multiple cloning site


pQE-82L Sequence

LOCUS       Exported                4752 bp ds-DNA     circular SYN 08-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4752)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 8, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4752
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             97..108
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             127..144
                     /product="6xHis affinity tag"
     terminator      209..303
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             347..1006
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1071..1157
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     CDS             complement(1250..2332)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2333..2410)
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     misc_feature    2602..2742
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(2928..3516)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3687..4547)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
