pQE- 9 Plasmid


  • Model: PVT0507
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-9,Plasmid pQE-9,pQE-9 vector


pQE-9 Information

Replicon: Ori

Terminator: Lambda t0

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 3439bp

Plasmid label: N-His

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: M15

Culture conditions: 37 centigrade, aerobic, LB

Induction mode: no induction

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE-9 Description

pQE-9 vector


pQE-9 Sequence

LOCUS       Exported                3439 bp ds-DNA     circular SYN 08-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 5
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3439)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 8, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3439
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             97..108
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             127..144
                     /product="6xHis affinity tag"
     terminator      186..280
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             324..983
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1048..1134
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     misc_feature    1289..1429
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(1615..2203)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2374..3234)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3235..3339)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatcgcatc accatcacca tcacggatcc gtcgacctgc agccaagctt aattagctga
      181 gcttggactc ctgttgatag atccagtaat gacctcagaa ctccatctgg atttgttcag
      241 aacgctcggt tgccgccggg cgttttttat tggtgagaat ccaagctagc ttggcgagat
      301 tttcaggagc taaggaagct aaaatggaga aaaaaatcac tggatatacc accgttgata
      361 tatcccaatg gcatcgtaaa gaacattttg aggcatttca gtcagttgct caatgtacct
      421 ataaccagac cgttcagctg gatattacgg cctttttaaa gaccgtaaag aaaaataagc
      481 acaagtttta tccggccttt attcacattc ttgcccgcct gatgaatgct catccggaat
      541 ttcgtatggc aatgaaagac ggtgagctgg tgatatggga tagtgttcac ccttgttaca
      601 ccgttttcca tgagcaaact gaaacgtttt catcgctctg gagtgaatac cacgacgatt
      661 tccggcagtt tctacacata tattcgcaag atgtggcgtg ttacggtgaa aacctggcct
      721 atttccctaa agggtttatt gagaatatgt ttttcgtctc agccaatccc tgggtgagtt
      781 tcaccagttt tgatttaaac gtggccaata tggacaactt cttcgccccc gttttcacca
      841 tgggcaaata ttatacgcaa ggcgacaagg tgctgatgcc gctggcgatt caggttcatc
      901 atgccgtttg tgatggcttc catgtcggca gaatgcttaa tgaattacaa cagtactgcg
      961 atgagtggca gggcggggcg taattttttt aaggcagtta ttggtgccct taaacgcctg
     1021 gggtaatgac tctctagctt gaggcatcaa ataaaacgaa aggctcagtc gaaagactgg
     1081 gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc tgagtaggac aaatccgccc
     1141 tctagagctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc
     1201 cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg
     1261 cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg
     1321 gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat
     1381 gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc
     1441 ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca
     1501 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg
     1561 agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca
     1621 taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa
     1681 cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc
     1741 tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc
     1801 gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct
     1861 gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg
     1921 tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag
     1981 gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta
     2041 cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg
     2101 aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt
     2161 tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt
     2221 ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag
     2281 attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat
     2341 ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc
     2401 tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
     2461 aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc
     2521 acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag
     2581 aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag
     2641 agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt
     2701 ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg
     2761 agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt
     2821 tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc
     2881 tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc
     2941 attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa
     3001 taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg
     3061 aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc
     3121 caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag
     3181 gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt
     3241 cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt
     3301 tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc
     3361 acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac
     3421 gaggcccttt cgtcttcac

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
