pQE-70

$280.00

  • Model: PVTY01151
  • 20 Units in Stock
Ask a question


Add to Cart:

pQE-70

PVTY01151  2ug

pQE-70 Description

Alias: pQE70, pQE 70 Plasmid type: E.coli Expression Vector Copy number: Low copy Promoter: T5 Cloning Method: Multiple cloning sites,restriction endonuclease Size: 3426 bp 5' Sequencing primers and sequences: pQE30-F: AGCGGATAACAATTTCACACAG 3' Sequencing primers and sequences: pQE30-R: TTCTGAGGTCATTACTGGATC Tags: C-His Resistance(s): Ampicillin (Amp)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart