pQE-9

$280.00

  • Model: PVTY01155
  • 20 Units in Stock
Ask a question


Add to Cart:

pQE-9

PVTY01155  2ug

pQE-9 Description

Alias: pQE9, pQE 9 Plasmid type: E.coli Expression Vector Copy number: Low copy Promoter: T5 Cloning Method: Multiple cloning sites,restriction endonuclease Size: 3439 bp 5' Sequencing primers and sequences: pQE30-F: AGCGGATAACAATTTCACACAG 3' Sequencing primers and sequences: pQE30-R: TTCTGAGGTCATTACTGGATC Tags: N-His Resistance(s): Ampicillin (Amp) Note: pQE vectors and constructs can be maintained in any E. coli strain that is ampicillin-sensitive and carries the pREP4 repressor plasmid, or harbors the lacIq gene on the F-factor episome.

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart