pRL- TK Plasmid


  • Model: PVT1316
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pRL-TK,Plasmid pRL-TK,pRL-TK vector


pRL-TK Information

Promoter: HSV TK, T7

Replicon: pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 4045bp

Prokaryotic resistance: Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: T7:TAATACGACTCACTATAGGG

Primers for 3'sequencing: primers designed based on sequences


pRL-TK Description
The pRL-TK Vector may be used in combination with any experimental reporter vector to cotransfect mammalian cells. However, it is important to realize that trans effects between promoters on cotransfected plasmids can potentially affect reporter gene expression. This is primarily of concern when either the control or experimental reporter vector, or both, contain very strong promoter/enhancer elements.The occurrence and magnitude of such effects will depend on several factors: i) the combination and activities of the genetic regulatory elements present on the cotransfected vectors, ii) the relative ratio of experimental vector to control vector introduced into the cells, and iii) the type of cell transfected.


pRL-TK Multiple cloning site



pRL-TK Sequence

LOCUS       Exported File           4045 bp ds-DNA    circular SYN 01-4-2015
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4045)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-4-1 
FEATURES             Location/Qualifiers
     source          1..4045
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        8..759
                     /note="HSV TK promoter"
                     /note="herpes simplex virus thymidine kinase promoter"
     intron          829..961
                     /note="chimeric intron"
                     /note="chimera between introns from human?beta-globin and 
                     immunoglobulin heavy chain genes"
     promoter        1006..1024
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     polyA_signal    2000..2121
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     promoter        2254..2358
                     /note="AmpR promoter"
     CDS             2359..3219
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      3390..3978
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 agatctaaat gagtcttcgg acctcgcggg ggccgcttaa gcggtggtta gggtttgtct
       61 gacgcggggg gagggggaag gaacgaaaca ctctcattcg gaggcggctc ggggtttggt
      121 cttggtggcc acgggcacgc agaagagcgc cgcgatcctc ttaagcaccc ccccgccctc
      181 cgtggaggcg ggggtttggt cggcgggtgg taactggcgg gccgctgact cgggcgggtc
      241 gcgcgcccca gagtgtgacc ttttcggtct gctcgcagac ccccgggcgg cgccgccgcg
      301 gcggcgacgg gctcgctggg tcctaggctc catggggacc gtatacgtgg acaggctctg
      361 gagcatccgc acgactgcgg tgatattacc ggagaccttc tgcgggacga gccgggtcac
      421 gcggctgacg cggagcgtcc gttgggcgac aaacaccagg acggggcaca ggtacactat
      481 cttgtcaccc ggaggcgcga gggactgcag gagcttcagg gagtggcgca gctgcttcat
      541 ccccgtggcc cgttgctcgc gtttgctggc ggtgtccccg gaagaaatat atttgcatgt
      601 ctttagttct atgatgacac aaaccccgcc cagcgtcttg tcattggcga attcgaacac
      661 gcagatgcag tcggggcggc gcggtcccag gtccacttcg catattaagg tgacgcgtgt
      721 ggcctcgaac accgagcgac cctgcagcga cccgcttaaa agcttgattc ttctgacaca
      781 acagtctcga acttaagctg cagaagttgg tcgtgaggca ctgggcaggt aagtatcaag
      841 gttacaagac aggtttaagg agaccaatag aaactgggct tgtcgagaca gagaagactc
      901 ttgcgtttct gataggcacc tattggtctt actgacatcc actttgcctt tctctccaca
      961 ggtgtccact cccagttcaa ttacagctct taaggctaga gtacttaata cgactcacta
     1021 taggctagcc accatgactt cgaaagttta tgatccagaa caaaggaaac ggatgataac
     1081 tggtccgcag tggtgggcca gatgtaaaca aatgaatgtt cttgattcat ttattaatta
     1141 ttatgattca gaaaaacatg cagaaaatgc tgttattttt ttacatggta acgcggcctc
     1201 ttcttattta tggcgacatg ttgtgccaca tattgagcca gtagcgcggt gtattatacc
     1261 agaccttatt ggtatgggca aatcaggcaa atctggtaat ggttcttata ggttacttga
     1321 tcattacaaa tatcttactg catggtttga acttcttaat ttaccaaaga agatcatttt
     1381 tgtcggccat gattggggtg cttgtttggc atttcattat agctatgagc atcaagataa
     1441 gatcaaagca atagttcacg ctgaaagtgt agtagatgtg attgaatcat gggatgaatg
     1501 gcctgatatt gaagaagata ttgcgttgat caaatctgaa gaaggagaaa aaatggtttt
     1561 ggagaataac ttcttcgtgg aaaccatgtt gccatcaaaa atcatgagaa agttagaacc
     1621 agaagaattt gcagcatatc ttgaaccatt caaagagaaa ggtgaagttc gtcgtccaac
     1681 attatcatgg cctcgtgaaa tcccgttagt aaaaggtggt aaacctgacg ttgtacaaat
     1741 tgttaggaat tataatgctt atctacgtgc aagtgatgat ttaccaaaaa tgtttattga
     1801 atcggaccca ggattctttt ccaatgctat tgttgaaggt gccaagaagt ttcctaatac
     1861 tgaatttgtc aaagtaaaag gtcttcattt ttcgcaagaa gatgcacctg atgaaatggg
     1921 aaaatatatc aaatcgttcg ttgagcgagt tctcaaaaat gaacaataat tctagagcgg
     1981 ccgcttcgag cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg
     2041 cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt
     2101 ataagctgca ataaacaagt taacaacaac aattgcattc attttatgtt tcaggttcag
     2161 ggggaggtgt gggaggtttt ttaaagcaag taaaacctct acaaatgtgg taaaatcgat
     2221 aaggatccag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc
     2281 taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa
     2341 tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt
     2401 gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct
     2461 gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc
     2521 cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta
     2581 tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac
     2641 tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc
     2701 atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac
     2761 ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg
     2821 gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac
     2881 gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc
     2941 gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt
     3001 gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga
     3061 gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc
     3121 cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag
     3181 atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca
     3241 tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
