pROKII Plasmid

$216.00

  • Model: PVT3001
  • 50 Units in Stock
Ask a question


Add to Cart:

pROKII

Search name

pROKII,Plasmid pROKII,pROKII vector

pROKII Plasmid information

Promoter: CaMV 35S
Replicon: ori
Terminator: NOS
Plasmid classification: plant series, protein overexpression vector
Plasmid size: 12880bp
Prokaryotic resistance: Kan
Screening markers: Neo
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
5'sequencing primers: 35S:GACGCACAATCCCACTATCC
3'sequencing primers: primers designed according to sequence
Use: Plant expression

pROKII Plasmid descrption
An intron sequence of Poptr;CYCD1;1 from Populus trichocarpa was ligated into binary vector,pROK

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart