pROKII- RNAI Plasmid

$182.00

  • Model: PVT3202
  • 50 Units in Stock
Ask a question


Add to Cart:

pROKII-RNAI

Search name

pROKII-RNAI,Plasmid pROKII-RNAI,pROKII-RNAI vector

 

pROKII- RNAI Information

Bacterial Resistance:Kanamycin
Growth Strain: DH5α
Expression: Plant
Use: RNAi

---------------------------------
Promoter: CaMV 35S

Terminator: NOS

Plasmid classification: plant series, RNAi vector

Plasmid size: 12880bp

Prokaryotic resistance: Kan

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

 

pROKII- RNAI Description

siRNA) caused by RNA (interference RNA short)Interference (RNAi) is a very effective test method. It is a creature The body of a molecule by double stranded RNA (dsRNA) molecules to make specific Degradation of the sequence of mRNA resulted in the silencing of gene expression. This phenomenon occurs at the post transcriptional level, that is, sequence specific Post transcriptional gene silencing.

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart