

  • Model: PVT4041
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4041      2ug

pRS315 Information

Promoter: LEU2, T7, T3
Replicator: pUC ori, FI ori
Plasmid classification: yeast series, Saccharomyces cerevisiae expression vector
Plasmid size: 6018bp
Prokaryotic resistance: Amp
Screening markers: LEU2
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: yeast cells
Induction method: galactose induction
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: primers designed according to sequence
Use: Yeast expression


pRS315 Description

pRS315 is one of a series of pBluescriptbased YCtype(centromeric) yeast shuttle vectors (ATCC 7714277145) differing in the yeast selectable marker gene. This vector carries the LEU2 selectable marker. It also encodes the beta galactosidase alpha peptide for bluewhite color detection of inserts and also has the T7 and T3 promoters for in vitro RNA synthesis and priming sites for sequencing. It is useful in plasmid shuffling experiments. It was constructed by inserting a 2.235 kb fragment containing the LEU2 gene into the NdeI site of the pRSS56 vector and also inserting a cassette containing CEN6 and the ARS associated with histone 4 (ARSH4) into the AatII site of the same vector. All ends were blunted. The pRSS56 vector was constructed by ligating a PvuI fragment (bp 4982412) of pBluescript KS+ and the fragment from the unique NdeI and AatII sites between bla and f1 origin of pBS(+). The order of the major features in this plasmid is: LEU2 f1 ori (NaeI) T7 promoter lacZ/MCS T3 promoter pMB1 ori bla CEN6 ARSH4.



pRS315 Sequence

LOCUS       Exported                6018 bp ds-DNA     circular SYN 12-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 5

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 6018)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, September 12, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..6018

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             complement(663..1757)


                     /gene="S. cerevisiae LEU2"

                     /product="3-isopropylmalate dehydrogenase, required for 

                     leucine biosynthesis"


                     /note="yeast auxotrophic marker"








     promoter        complement(1770..2174)

                     /gene="S. cerevisiae LEU2"

                     /note="LEU2 promoter"

     rep_origin      complement(2474..2929)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     CDS             complement(2712..3287)


                     /gene="lacZ fragment"

                     /product="LacZ-alpha fragment of beta-galactosidase"






     primer_bind     3074..3090

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     promoter        3097..3115

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     misc_feature    3124..3231


                     /note="pBluescript multiple cloning site"

     primer_bind     3148..3164

                     /note="SK primer"

                     /note="common sequencing primer, one of multiple similar 


     primer_bind     complement(3198..3214)

                     /note="KS primer"

                     /note="common sequencing primer, one of multiple similar 


     promoter        complement(3244..3262)

                     /note="T3 promoter"

                     /note="promoter for bacteriophage T3 RNA polymerase"

     primer_bind     complement(3283..3299)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    3307..3323

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(3331..3361)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     rep_origin      complement(3685..4273)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4444..5304)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(5305..5409)


                     /note="AmpR promoter"

     misc_feature    5446..5949


                     /note="S. cerevisiae CEN6 centromere fused to an 

                     autonomously replicating sequence"


        1 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca

       61 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg

      121 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc

      181 accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc

      241 accattatgg gaaatggttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca

      301 ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat

      361 taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc

      421 ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc

      481 aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt

      541 agattgcgta tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg

      601 tttctattat gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct

      661 ttttaagcaa ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg

      721 ttggaaccac ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct

      781 tcaatggcct taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac

      841 aagatagtgg cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat

      901 ggttcgtaca aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc

      961 aacaaaccca aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg

     1021 ttgctggtga ttataatacc atttaggtgg gttgggttct taactaggat catggcggca

     1081 gaatcaatca attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc

     1141 acagtttttc tccataatct tgaagaggcc aaaacattag ctttatccaa ggaccaaata

     1201 ggcaatggtg gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact

     1261 tctggaacgg tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc

     1321 ttaccaaagt aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca

     1381 aattgtggct tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt

     1441 aagttggcgt acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca

     1501 ctaccggtac cccatttagg accacccaca gcacctaaca aaacggcatc aaccttcttg

     1561 gaggcttcca gcgcctcatc tggaagtggg acacctgtag catcgatagc agcaccacca

     1621 attaaatgat tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga

     1681 accttaatgg cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc

     1741 ttcttagggg cagacatagg ggcagacatt agaatggtat atccttgaaa tatatatata

     1801 tattgctgaa atgtaaaagg taagaaaagt tagaaagtaa gacgattgct aaccacctat

     1861 tggaaaaaac aataggtcct taaataatat tgtcaacttc aagtattgtg atgcaagcat

     1921 ttagtcatga acgcttctct attctatatg aaaagccggt tccggcctct cacctttcct

     1981 ttttctccca atttttcagt tgaaaaaggt atatgcgtca ggcgacctct gaaattaaca

     2041 aaaaatttcc agtcatcgaa tttgattctg tgcgatagcg cccctgtgtg ttctcgttat

     2101 gttgaggaaa aaaataatgg ttgctaagag attcgaactc ttgcatctta cgatacctga

     2161 gtattcccac agttaactgc ggtcaagata tttcttgaat caggcgcctt agaccgctcg

     2221 gccaaacaac caattacttg ttgagaaata gagtataatt atcctataaa tataacgttt

     2281 ttgaacacac atgaacaagg aagtacagga caattgattt tgaagagaat gtggattttg

     2341 atgtaattgt tgggattcca tttttaataa ggcaataata ttaggtatgt ggatatacta

     2401 gaagttctcc tcgagggtcg atatgcggtg tgaaataccg cacagatgcg taaggagaaa

     2461 ataccgcatc aggaaattgt aaacgttaat attttgttaa aattcgcgtt aaatttttgt

     2521 taaatcagct cattttttaa ccaataggcc gaaatcggca aaatccctta taaatcaaaa

     2581 gaatagaccg agatagggtt gagtgttgtt ccagtttgga acaagagtcc actattaaag

     2641 aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg cccactacgt

     2701 gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc gtaaagcact aaatcggaac

     2761 cctaaaggga gcccccgatt tagagcttga cggggaaagc cggcgaacgt ggcgagaaag

     2821 gaagggaaga aagcgaaagg agcgggcgct agggcgctgg caagtgtagc ggtcacgctg

     2881 cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc gcgccattcg

     2941 ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc gctattacgc

     3001 cagctggcga aggggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc

     3061 cagtcacgac gttgtaaaac gacggccagt gaattgtaat acgactcact atagggcgaa

     3121 ttggagctcc accgcggtgg cggccgctct agaactagtg gatcccccgg gctgcaggaa

     3181 ttcgatatca agcttatcga taccgtcgac ctcgaggggg ggcccggtac ccagcttttg

     3241 ttccctttag tgagggttaa ttccgagctt ggcgtaatca tggtcatagc tgtttcctgt

     3301 gtgaaattgt tatccgctca caattccaca caacatagga gccggaagca taaagtgtaa

     3361 agcctggggt gcctaatgag tgaggtaact cacattaatt gcgttgcgct cactgcccgc

     3421 tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag

     3481 aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt

     3541 cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga

     3601 atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg

     3661 taaaaaggcc gcgttgctgg cgtttttcca taggctcggc ccccctgacg agcatcacaa

     3721 aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt

     3781 cccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct

     3841 gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct gtaggtatct

     3901 cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc

     3961 cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt

     4021 atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc

     4081 tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat

     4141 ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa

     4201 acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa

     4261 aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga

     4321 aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct

     4381 tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga

     4441 cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc

     4501 catagttgcc tgactgcccg tcgtgtagat aactacgata cgggagggct taccatctgg

     4561 ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat

     4621 aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat

     4681 ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg

     4741 caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc

     4801 attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgaaaaaa

     4861 agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc

     4921 actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt

     4981 ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag

     5041 ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt

     5101 gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag

     5161 atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac

     5221 cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc

     5281 gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca

     5341 gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg

     5401 ggttccgcgc acatttcccc gaaaagtgcc acctgggtcc ttttcatcac gtgctataaa

     5461 aataattata atttaaattt tttaatataa atatataaat taaaaataga aagtaaaaaa

     5521 agaaattaaa gaaaaaatag tttttgtttt ccgaagatgt aaaagactct agggggatcg

     5581 ccaacaaata ctacctttta tcttgctctt cctgctctca ggtattaatg ccgaattgtt

     5641 tcatcttgtc tgtgtagaag accacacacg aaaatcctgt gattttacat tttacttatc

     5701 gttaatcgaa tgtatatcta tttaatctgc ttttcttgtc taataaatat atatgtaaag

     5761 tacgcttttt gttgaaattt tttaaacctt tgtttatttt tttttcttca ttccgtaact

     5821 cttctacctt ctttatttac tttctaaaat ccaaatacaa aacataaaaa taaataaaca

     5881 cagagtaaat tcccaaatta ttccatcatt aaaagatacg aggcgcgtgt aagttacagg

     5941 caagcgatcc gtcctaagaa accattatta tcatgacatt aacctataaa aataggcgta

     6001 tcacgaggcc ctttcgtc



Product is for research use only!


Search name

pRS315,Plasmid pRS315,pRS315 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
