pRS315 Plasmid


  • Model: PVT4041
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pRS315,Plasmid pRS315,pRS315 vector


pRS315 Information

Promoter: LEU2, T7, T3
Replicator: pUC ori, FI ori
Plasmid classification: yeast series, Saccharomyces cerevisiae expression vector
Plasmid size: 6018bp
Prokaryotic resistance: Amp
Screening markers: LEU2
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: yeast cells
Induction method: galactose induction
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: primers designed according to sequence
Use: Yeast expression


pRS315 Description

pRS315 is one of a series of pBluescriptbased YCtype(centromeric) yeast shuttle vectors (ATCC 7714277145) differing in the yeast selectable marker gene. This vector carries the LEU2 selectable marker. It also encodes the beta galactosidase alpha peptide for bluewhite color detection of inserts and also has the T7 and T3 promoters for in vitro RNA synthesis and priming sites for sequencing. It is useful in plasmid shuffling experiments. It was constructed by inserting a 2.235 kb fragment containing the LEU2 gene into the NdeI site of the pRSS56 vector and also inserting a cassette containing CEN6 and the ARS associated with histone 4 (ARSH4) into the AatII site of the same vector. All ends were blunted. The pRSS56 vector was constructed by ligating a PvuI fragment (bp 4982412) of pBluescript KS+ and the fragment from the unique NdeI and AatII sites between bla and f1 origin of pBS(+). The order of the major features in this plasmid is: LEU2 f1 ori (NaeI) T7 promoter lacZ/MCS T3 promoter pMB1 ori bla CEN6 ARSH4.



pRS315 Sequence

LOCUS       Exported                6018 bp ds-DNA     circular SYN 12-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 5

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 6018)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, September 12, 2016 from SnapGene Viewer 3.1.4


FEATURES             Location/Qualifiers

     source          1..6018

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             complement(663..1757)


                     /gene="S. cerevisiae LEU2"

                     /product="3-isopropylmalate dehydrogenase, required for 

                     leucine biosynthesis"


                     /note="yeast auxotrophic marker"








     promoter        complement(1770..2174)

                     /gene="S. cerevisiae LEU2"

                     /note="LEU2 promoter"

     rep_origin      complement(2474..2929)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     CDS             complement(2712..3287)


                     /gene="lacZ fragment"

                     /product="LacZ-alpha fragment of beta-galactosidase"






     primer_bind     3074..3090

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     promoter        3097..3115

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     misc_feature    3124..3231


                     /note="pBluescript multiple cloning site"

     primer_bind     3148..3164

                     /note="SK primer"

                     /note="common sequencing primer, one of multiple similar 


     primer_bind     complement(3198..3214)

                     /note="KS primer"

                     /note="common sequencing primer, one of multiple similar 


     promoter        complement(3244..3262)

                     /note="T3 promoter"

                     /note="promoter for bacteriophage T3 RNA polymerase"

     primer_bind     complement(3283..3299)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    3307..3323

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(3331..3361)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     rep_origin      complement(3685..4273)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4444..5304)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
