pRS316 Plasmid

$216.00

  • Model: PVT4042
  • 50 Units in Stock
Ask a question


Add to Cart:

pRS316

Search name

pRS316,Plasmid pRS316,pRS316 vector

 

pRS316 Informaiton

Promoter: URA3, T7, T3

Replicator: pUC ori, FI ori

Plasmid classification: yeast series, Saccharomyces cerevisiae expression vector

Plasmid size: 4887bp

Prokaryotic resistance: Amp

Screening markers: URA3

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Induction method: galactose induction

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: M13R:CAGGAAACAGCTATGACC

Use: Yeast expression

 

pRS316 Description

This is one of a series of pBluescript­based YC­type (centromeric) yeast shuttle vectors (ATCC 77142­77145) differing in the yeast selectable marker gene. It encodes the beta galactosidase alpha peptide for blue­ white color detection of inserts and also has the T7 and T3 promoters for in vitro RNA synthesis and priming sites for sequencing. It is useful in plasmid shuffling experiments. It was constructed by inserting a 1.112 kb fragment containing the URA3 gene into the NdeI site of the pRSS56 vector and also inserting a cassette containing CEN6 and the ARS associated with histone 4 (ARSH4) into the AatII site of the same vector. All ends were blunted. The pRSS56 vector was constructed by ligating a PvuI fragment (bp 498­2412) of pBluescript KS+ and the fragment from the unique NdeI and AatII sites between bla and f1 origin of pBS(+). The order of the major features in this plasmid is: URA3

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart