pRS423 Plasmid


  • Model: PVT4044
  • 50 Units in Stock
Ask a question

Add to Cart:

pRS423 Plasmid

PVT4044     2ug


pRS423 Informaiton

Promoter: HIS3, T7, T3

Replicator: 2 ori, ori, FI ori

Plasmid classification: yeast series, Saccharomyces cerevisiae expression vector.

Plasmid size: 5797bp

Prokaryotic resistance: Amp

Screening markers: HIS3

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Induction method: galactose induction

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: primers designed according to sequence

Use: Yeast expression


pRS423 Decription

A YEtype(episomal) E. coli/S. cerevisiae shuttle vector permitting RNA synthesis in vitro, visual detection of recombinants, production of single stranded DNA and containing primer sites useful for sequencing Designation: pRS423



pRS423 Sequence

LOCUS       Exported                5797 bp ds-DNA     circular SYN 25-MAY-2016

DEFINITION  synthetic circular DNA




SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5797)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, September 12, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..5797

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     rep_origin      68..1410

                     /note="2u ori"

                     /note="yeast 2u plasmid origin of replication"

     protein_bind    400..447

                     /bound_moiety="FLP recombinase from the Saccharomyces 

                     cerevisiae 2u plasmid"


                     /note="FLP-mediated recombination occurs in the 8-bp core 

                     sequence TCTAGAAA (Turan and Bode, 2011)."

     promoter        1437..1541


                     /note="AmpR promoter"

     CDS             1542..2402





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      2573..3161



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     promoter        3485..3515

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    3523..3539

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     3547..3563

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     CDS             3559..4137


                     /gene="lacZ fragment"

                     /product="LacZ-alpha fragment of beta-galactosidase"






     promoter        3584..3602

                     /note="T3 promoter"

                     /note="promoter for bacteriophage T3 RNA polymerase"

     misc_feature    3615..3722


                     /note="pBluescript multiple cloning site"

     primer_bind     3639..3655

                     /note="SK primer"

                     /note="common sequencing primer, one of multiple similar 


     primer_bind     complement(3689..3705)

                     /note="KS primer"

                     /note="common sequencing primer, one of multiple similar 


     promoter        complement(3731..3749)

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     primer_bind     complement(3759..3775)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     rep_origin      3920..4375


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     CDS             complement(4635..5294)


                     /gene="S. cerevisiae HIS3"

                     /product="imidazoleglycerol-phosphate dehydratase, required

                     for histidine biosynthesis"


                     /note="yeast auxotrophic marker"





     promoter        complement(5295..5481)

                     /gene="S. cerevisiae HIS3"

                     /note="HIS3 promoter"


        1 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt

       61 cttagatgat ccaatatcaa aggaaatgat agcattgaag gatgagacta atccaattga

      121 ggagtggcag catatagaac agctaaaggg tagtgctgaa ggaagcatac gataccccgc

      181 atggaatggg ataatatcac aggaggtact agactacctt tcatcctaca taaatagacg

      241 catataagta cgcatttaag cataaacacg cactatgccg ttcttctcat gtatatatat

      301 atacaggcaa cacgcagata taggtgcgac gtgaacagtg agctgtatgt gcgcagctcg

      361 cgttgcattt tcggaagcgc tcgttttcgg aaacgctttg aagttcctat tccgaagttc

      421 ctattctcta gaaagtatag gaacttcaga gcgcttttga aaaccaaaag cgctctgaag

      481 acgcactttc aaaaaaccaa aaacgcaccg gactgtaacg agctactaaa atattgcgaa

      541 taccgcttcc acaaacattg ctcaaaagta tctctttgct atatatctct gtgctatatc

      601 cctatataac ctacccatcc acctttcgct ccttgaactt gcatctaaac tcgacctcta

      661 cattttttat gtttatctct agtattactc tttagacaaa aaaattgtag taagaactat

      721 tcatagagtg aatcgaaaac aatacgaaaa tgtaaacatt tcctatacgt agtatataga

      781 gacaaaatag aagaaaccgt tcataatttt ctgaccaatg aagaatcatc aacgctatca

      841 ctttctgttc acaaagtatg cgcaatccac atcggtatag aatataatcg gggatgcctt

      901 tatcttgaaa aaatgcaccc gcagcttcgc tagtaatcag taaacgcggg aagtggagtc

      961 aggctttttt tatggaagag aaaatagaca ccaaagtagc cttcttctaa ccttaacgga

     1021 cctacagtgc aaaaagttat caagagactg cattatagag cgcacaaagg agaaaaaaag

     1081 taatctaaga tgctttgtta gaaaaatagc gctctcggga tgcatttttg tagaacaaaa

     1141 aagaagtata gattctttgt tggtaaaata gcgctctcgc gttgcatttc tgttctgtaa

     1201 aaatgcagct cagattcttt gtttgaaaaa ttagcgctct cgcgttgcat ttttgtttta

     1261 caaaaatgaa gcacagattc ttcgttggta aaatagcgct ttcgcgttgc atttctgttc

     1321 tgtaaaaatg cagctcagat tctttgtttg aaaaattagc gctctcgcgt tgcatttttg

     1381 ttctacaaaa tgaagcacag atgcttcgtt caggtggcac ttttcgggga aatgtgcgcg

     1441 gaacccctat ttgtttattt ttctaaatac attcaaatat gtatccgctc atgagacaat

     1501 aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt caacatttcc

     1561 gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct cacccagaaa

     1621 cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt tacatcgaac

     1681 tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt tttccaatga

     1741 tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgac gccgggcaag

     1801 agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac tcaccagtca

     1861 cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct gccataacca

     1921 tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg aaggagctaa

     1981 ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg gaaccggagc

     2041 tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca atggcaacaa

     2101 cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa caattaatag

     2161 actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt ccggctggct

     2221 ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc attgcagcac

     2281 tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg agtcaggcaa

     2341 ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt aagcattggt

     2401 aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt catttttaat

     2461 ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg

     2521 agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc

     2581 ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg

     2641 tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag

     2701 cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac ttcaagaact

     2761 ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg

     2821 gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc

     2881 ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg

     2941 aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa gggagaaagg

     3001 cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag

     3061 ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc

     3121 gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct

     3181 ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct gcgttatccc

     3241 ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct cgccgcagcc

     3301 gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgccca atacgcaaac

     3361 cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg gcacgacagg tttcccgact

     3421 ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta cctcactcat taggcacccc

     3481 aggctttaca ctttatgctt ccggctccta tgttgtgtgg aattgtgagc ggataacaat

     3541 ttcacacagg aaacagctat gaccatgatt acgccaagcg cgcaattaac cctcactaaa

     3601 gggaacaaaa gctggagctc caccgcggtg gcggccgctc tagaactagt ggatcccccg

     3661 ggctgcagga attcgatatc aagcttatcg ataccgtcga cctcgagggg gggcccggta

     3721 cccaattcgc cctatagtga gtcgtattac gcgcgctcac tggccgtcgt tttacaacgt

     3781 cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca tccccctttc

     3841 gccagctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca gttgcgcagc

     3901 ctgaatggcg aatggcgcga cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg

     3961 gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc

     4021 ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc

     4081 cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt

     4141 gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag

     4201 tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg

     4261 gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag

     4321 ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgtttac aatttcctga

     4381 tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcatagat ccgtcgagtt

     4441 caagagaaaa aaaaagaaaa agcaaaaaga aaaaaggaaa gcgcgcctcg ttcagaatga

     4501 cacgtataga atgatgcatt accttgtcat cttcagtatc atactgttcg tatacatact

     4561 tactgacatt cataggtata catatataca catgtatata tatcgtatgc tgcagcttta

     4621 aataatcggt gtcactacat aagaacacct ttggtggagg gaacatcgtt ggtaccattg

     4681 ggcgaggtgg cttctcttat ggcaaccgca agagccttga acgcactctc actacggtga

     4741 tgatcattct tgcctcgcag acaatcaacg tggagggtaa ttctgctagc ctctgcaaag

     4801 ctttcaagaa aatgcgggat catctcgcaa gagagatctc ctactttctc cctttgcaaa

     4861 ccaagttcga caactgcgta cggcctgttc gaaagatcta ccaccgctct ggaaagtgcc

     4921 tcatccaaag gcgcaaatcc tgatccaaac ctttttactc cacgcgccag tagggcctct

     4981 ttaaaagctt gaccgagagc aatcccgcag tcttcagtgg tgtgatggtc gtctatgtgt

     5041 aagtcaccaa tgcactcaac gattagcgac cagccggaat gcttggccag agcatgtatc

     5101 atatggtcca gaaaccctat acctgtgtgg acgttaatca cttgcgattg tgtggcctgt

     5161 tctgctactg cttctgcctc tttttctggg aagatcgagt gctctatcgc taggggacca

     5221 ccctttaaag agatcgcaat ctgaatcttg gtttcatttg taatacgctt tactagggct

     5281 ttctgctctg tcatctttgc cttcgtttat cttgcctgct cattttttag tatattcttc

     5341 gaagaaatca cattacttta tataatgtat aattcattat gtgataatgc caatcgctaa

     5401 gaaaaaaaaa gagtcatccg ctaggggaaa aaaaaaaatg aaaatcatta ccgaggcata

     5461 aaaaaatata gagtgtacta gaggaggcca agagtaatag aaaaagaaaa ttgcgggaaa

     5521 ggactgtgtt atgacttccc tgactaatgc cgtgttcaaa cgatacctgg cagtgactcc

     5581 tagcgctcac caagctctta aaacgggaat ttatggtgca ctctcagtac aatctgctct

     5641 gatgccgcat agttaagcca gccccgacac ccgccaacac ccgctgacgc gccctgacgg

     5701 gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg gagctgcatg

     5761 tgtcagaggt tttcaccgtc atcaccgaaa cgcgcga


Product is for research use only!


Search name

pRS423,Plasmid pRS423,pRS423 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
