pRSETA Plasmid


  • Model: PVT0813
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0813   2ug

Search name

pRSETA,Plasmid pRSETA,pRSETA vector


pRSETA Informaiton

Alias: pRSET A

Promoter: T7/lac

Replicon: pUC ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; pRSET series expression plasmid

Plasmid size: 2897bp

Plasmid tagging: N-His, N-EK, N-Xpress

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: BL21 (DE3) series, recommended BL21Star (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG

Remarks: pRSET expression plasmid


pRSETA Description

PRSET A vector is derived from pUC vector. The purpose of vector design is to clone genes for high level expression and purification in E. coli. The T7 promoter on the vector made it possible for pRSETA vector to express the gene sequence of cloning highly. In addition, the DNA insertion fragment is located downstream of the vector, and the upstream protein coding frame is consistent. The upstream coding sequence expresses a N-terminal fusion peptide. The sequence consists of an ATG translation initiation codon, a 6X His tag, a stable transcriptional sequence derived from phage T7 gene 10, an Xpress antigen epitope, and an enterokinase cleavage recognition sequence. The His label allows simple Ni column protein purification. Enterokinase recognition sites are located between the His tag and the recombinant protein, which facilitate the subsequent removal of the N-terminal fusion peptide of the recombinant protein.


pRSETA Multiple cloning site



pRSETA Sequence

LOCUS       Exported                2897 bp ds-DNA    circular SYN 11-9-2015
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 2897)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-9-11     
FEATURES             Location/Qualifiers
     source          1..2897
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        20..38
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             112..129
                     /product="6xHis affinity tag"
     CDS             133..165
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     CDS             169..192
                     /product="Xpress(TM) epitope tag, including an enterokinase
                     recognition and cleavage site"
                     /note="Xpress(TM) tag"
     terminator      312..359
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     rep_origin      456..911
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        937..1041
                     /note="AmpR promoter"
     CDS             1042..1902
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2073..2661
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
        1 gatctcgatc ccgcgaaatt aatacgactc actataggga gaccacaacg gtttccctct
       61 agaaataatt ttgtttaact ttaagaagga gatatacata tgcggggttc tcatcatcat
      121 catcatcatg gtatggctag catgactggt ggacagcaaa tgggtcggga tctgtacgac
      181 gatgacgata aggatcgatg gggatccgag ctcgagatct gcagctggta ccatggaatt
      241 cgaagcttga tccggctgct aacaaagccc gaaaggaagc tgagttggct gctgccaccg
      301 ctgagcaata actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc
      361 tgaaaggagg aactatatcc ggatctggcg taatagcgaa gaggcccgca ccgatcgccc
      421 ttcccaacag ttgcgcagcc tgaatggcga atgggacgcg ccctgtagcg gcgcattaag
      481 cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc
      541 cgctcctttc gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc
      601 tctaaatcgg gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa
      661 aaaacttgat tagggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg
      721 ccctttgacg ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac
      781 actcaaccct atctcggtct attcttttga tttataaggg attttgccga tttcggccta
      841 ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca aaatattaac
      901 gcttacaatt taggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt
      961 ttctaaatac attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa
     1021 taatattgaa aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt
     1081 tttgcggcat tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat
     1141 gctgaagatc agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag
     1201 atccttgaga gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg
     1261 ctatgtggcg cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata
     1321 cactattctc agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat
     1381 ggcatgacag taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc
     1441 aacttacttc tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg
     1501 ggggatcatg taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac
     1561 gacgagcgtg acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact
     1621 ggcgaactac ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa
     1681 gttgcaggac cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct
     1741 ggagccggtg agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc
     1801 tcccgtatcg tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga
     1861 cagatcgctg agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac
     1921 tcatatatac tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag
     1981 atcctttttg ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg
     2041 tcagaccccg tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc
     2101 tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag
     2161 ctaccaactc tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtt
     2221 cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac
     2281 ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc
     2341 gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
