pSecTag2 A


  • Model: PVT1040
  • 50 Units in Stock
Ask a question

Add to Cart:

pSecTag2 A

PVT1040         2ug


pSecTag2 A Information


Promoter: CMV

Replicon: pUC ori, FI ori

Terminator: SV40 poly (A) signal, BGH poly (A) signal

Plasmid size: 5159bp

Prokaryotic resistance: ampicillin Amp

Screening marker: bleomycin Zeo

Clone strain: Escherichia coli DH5 alpha

Culture conditions: aerobic at 37 C, LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: BGH:TAGAAGGCACAGTCGAGG


pSecTag2 A Description

pSecTag2 A, B, and C vectors are fusion vectors requiring that you clone your gene of interest in frame with the initiation ATG of the N-terminal Igκ-chain leader sequence and/or the C-terminal myc epitope/polyhistidine tag. Three versions of this vector are provided to facilitate cloning. For proper expression,first determine which restriction sites are appropriate for ligation and then which vector will preserve the reading frame at BOTH the 5′ and the 3′ ends. It may be nece ssary to PCR your gene product to create a fragment with the appropriate restriction sites to clone in frame at both ends. Carefully inspect your gene and the multiple cloning site of each vector before cloning your gene of interest.


pSecTag2 A Multiple cloning site

pSecTag2 A vector


pSecTag2 A Sequence

LOCUS       Exported                5159 bp ds-DNA     circular SYN 29-AUG-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5159)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, August 29, 2016 from SnapGene Viewer 3.1.4   

FEATURES             Location/Qualifiers

     source          1..5159

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     enhancer        235..614

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        615..818

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     promoter        863..881

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     CDS             905..967


                     /product="leader sequence from mouse immunoglobulin kappa 

                     light chain"

                     /note="Ig-kappa leader"


     CDS             1082..1111


                     /product="Myc (human c-Myc oncogene) epitope tag"



     CDS             1127..1144


                     /product="6xHis affinity tag"



     polyA_signal    1173..1397

                     /note="bGH poly(A) signal"

                     /note="bovine growth hormone polyadenylation signal"

     rep_origin      1443..1871


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     promoter        1885..2214

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     rep_origin      2065..2200

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     promoter        2262..2309

                     /note="EM7 promoter"

                     /note="synthetic bacterial promoter "

     CDS             2328..2702


                     /gene="Sh ble from Streptoalloteichus hindustanus"

                     /product="antibiotic-binding protein"


                     /note="confers resistance to bleomycin, phleomycin, and 





     polyA_signal    2832..2953

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     primer_bind     complement(3002..3018)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    3026..3042

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(3050..3080)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    3095..3116

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(3404..3992)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4163..5023)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(5024..5128)


                     /note="AmpR promoter"


        1 gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg

       61 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg

      121 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc

      181 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt

      241 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata

      301 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc

      361 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc

      421 attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt

      481 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt

      541 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca

      601 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg

      661 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc

      721 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg

      781 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca

      841 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc

      901 caccatggag acagacacac tcctgctatg ggtactgctg ctctgggttc caggttccac

      961 tggtgacgcg gcccagccgg ccaggcgcgc cgtacgaagc ttggtaccga gctcggatcc

     1021 actccagtgt ggtggaattc tgcagatatc cagcacagtg gcggccgctc gaggagggcc

     1081 cgaacaaaaa ctcatctcag aagaggatct gaatagcgcc gtcgaccatc atcatcatca

     1141 tcattgagtt taaacccgct gatcagcctc gactgtgcct tctagttgcc agccatctgt

     1201 tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca ctgtcctttc

     1261 ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta ttctgggggg

     1321 tggggtgggg caggacagca agggggagga ttgggaagac aatagcaggc atgctgggga

     1381 tgcggtgggc tctatggctt ctgaggcgga aagaaccagc tggggctcta gggggtatcc

     1441 ccacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac

     1501 cgctacactt gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc

     1561 cacgttcgcc ggctttcccc gtcaagctct aaatcggggc atccctttag ggttccgatt

     1621 tagtgcttta cggcacctcg accccaaaaa acttgattag ggtgatggtt cacgtagtgg

     1681 gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag

     1741 tggactcttg ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt

     1801 ataagggatt ttggggattt cggcctattg gttaaaaaat gagctgattt aacaaaaatt

     1861 taacgcgaat taattctgtg gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc

     1921 ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaaag

     1981 tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc

     2041 atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct

     2101 ccgccccatg gctgactaat tttttttatt tatgcagagg ccgaggccgc ctctgcctct

     2161 gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctc

     2221 ccgggagctt gtatatccat tttcggatct gatcagcacg tgttgacaat taatcatcgg

     2281 catagtatat cggcatagta taatacgaca aggtgaggaa ctaaaccatg gccaagttga

     2341 ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag ttctggaccg

     2401 accggctcgg gttctcccgg gacttcgtgg aggacgactt cgccggtgtg gtccgggacg

     2461 acgtgaccct gttcatcagc gcggtccagg accaggtggt gccggacaac accctggcct

     2521 gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc gtgtccacga

     2581 acttccggga cgcctccggg ccggccatga ccgagatcgg cgagcagccg tgggggcggg

     2641 agttcgccct gcgcgacccg gccggcaact gcgtgcactt cgtggccgag gagcaggact

     2701 gacacgtgct acgagatttc gattccaccg ccgccttcta tgaaaggttg ggcttcggaa

     2761 tcgttttccg ggacgccggc tggatgatcc tccagcgcgg ggatctcatg ctggagttct

     2821 tcgcccaccc caacttgttt attgcagctt ataatggtta caaataaagc aatagcatca

     2881 caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca

     2941 tcaatgtatc ttatcatgtc tgtataccgt cgacctctag ctagagcttg gcgtaatcat

     3001 ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag

     3061 ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg

     3121 cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa

     3181 tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca

     3241 ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg

     3301 taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc

     3361 agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc

     3421 cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac

     3481 tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc

     3541 tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat

     3601 gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc

     3661 acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca

     3721 acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag

     3781 cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta

     3841 gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg

     3901 gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc

     3961 agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt

     4021 ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa

     4081 ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat

     4141 atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga

     4201 tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac

     4261 gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg

     4321 ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg

     4381 caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt

     4441 cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct

     4501 cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat

     4561 cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta

     4621 agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca

     4681 tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat

     4741 agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac

     4801 atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa

     4861 ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt

     4921 cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg

     4981 caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat

     5041 attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt

     5101 agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtc



Product is for research use only!


Search name

pSecTag2 A,Plasmid pSecTag2 A,pSecTag2 A vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
