pShuttle

$280.00

  • Model: PVTY00590
  • 20 Units in Stock
Ask a question


Add to Cart:

pShuttle

PVTY00590  2ug

pShuttle Description

GenBankID: AF334399 Plasmid type: Adenovirus system Copy Number: Low copy Promoter: CMV Size: 6568 bp 5' Sequencing primers and sequences: pShuttle-F: GAAGTGAAATCTGAATAATTTTGTG 3' Sequencing primers and sequences: pShuttle-R: CAAAACTACATAAGACCCCCAC Resistance(s): Kanamycin (Kan)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart