psiCHECK- 2


  • Model: PVT10837
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10837
Packing 2ug


psiCHECK-2 Information

Function Mammal reporter plasmid

Promoters: HSV TK, T7, SV40

Replicator: pUC ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 6273bp

Prokaryotic resistance: Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: primers designed according to sequence


psiCHECK-2 Description

psiCHEC-2 Vector is designed to provide a quantitative and rapid approach for optimization of RNA interference (RNAi). The vectors enable the monitoring of changes in expression of a target gene fused to the reporter gene. In both vectors, Renilla luciferase is used as a primary reporter gene, and the gene of interest can be cloned into the multiple cloning region located downstream of the Renilla luciferase translational stop codon. Initiation of the RNAi process toward a gene of interest results in cleavage and subsequent degradation of fusion mRNA. Measurement of decreased Renilla luciferase activity is a convenient indicator of RNAi effect . RNAi is a phenomenon by which double-stranded RNA complementary to a target mRNA can specifically inactivate gene function by stimulating the degradation of the target mRNA . Because of the ability to inactivate genes, RNAi has emerged as a powerful tool for analyzing gene function. In mammalian systems, including cultured mammalian cells, chemically synthesized double-stranded short interfering RNA molecules (<30 nucleotides; siRNA) result in dsRNA duplexes <30 base pairs in length that induce RNAi .RNAi duplexes >30bp induce the interferon response and nonspecific degradation of mRNA and cannot be used as tools for specific gene silencing .


psiCHECK-2 Multiple site



psiCHECK-2 Sequence

LOCUS       Exported                6273 bp ds-DNA     circular SYN 07-JUL-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6273)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, July 7, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..6273
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        62..419
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      270..405
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     intron          489..621
                     /note="chimeric intron"
                     /note="chimera between introns from human beta-globin and 
                     immunoglobulin heavy chain genes"
     promoter        666..684
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             694..1629
                     /product="Renilla luciferase"
                     /note="human codon-optimized"
     polyA_signal    1688..1736
                     /note="synthetic polyadenylation signal"
     promoter        1745..2496
                     /note="HSV TK promoter"
                     /note="herpes simplex virus thymidine kinase promoter"
     CDS             2532..4184
     polyA_signal    4228..4349
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     promoter        4482..4586
                     /note="AmpR promoter"
     CDS             4587..5447
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      5618..6206
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 agatctgcgc agcaccatgg cctgaaataa cctctgaaag aggaacttgg ttaggtacct
       61 tctgaggcgg aaagaaccag ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag
      121 gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca accaggtgtg
      181 gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag
      241 caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc
      301 attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg
      361 cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa
      421 agcttgattc ttctgacaca acagtctcga acttaagctg cagaagttgg tcgtgaggca
      481 ctgggcaggt aagtatcaag gttacaagac aggtttaagg agaccaatag aaactgggct
      541 tgtcgagaca gagaagactc ttgcgtttct gataggcacc tattggtctt actgacatcc
      601 actttgcctt tctctccaca ggtgtccact cccagttcaa ttacagctct taaggctaga
      661 gtacttaata cgactcacta taggctagcc accatggctt ccaaggtgta cgaccccgag
      721 caacgcaaac gcatgatcac tgggcctcag tggtgggctc gctgcaagca aatgaacgtg
      781 ctggactcct tcatcaacta ctatgattcc gagaagcacg ccgagaacgc cgtgattttt
      841 ctgcatggta acgctgcctc cagctacctg tggaggcacg tcgtgcctca catcgagccc
      901 gtggctagat gcatcatccc tgatctgatc ggaatgggta agtccggcaa gagcgggaat
      961 ggctcatatc gcctcctgga tcactacaag tacctcaccg cttggttcga gctgctgaac
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
