pSilencer 2.1- U6- Neo

$260.00

  • Model: PVT10867
  • 50 Units in Stock
Ask a question


Add to Cart:

pSilencer 2.1-U6-Neo


Catalog No. PVT10867
Packing 2ug

 

pSilencer 2.1-U6-Neo Information

Function Mammal Editing plasmids

Alias: pSilencer2.1-U6 Neo

Promoter: SV40, U6

Replicon: pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 4521bp

Prokaryotic resistance: Amp

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: U6:ATGGACTATCATATGCTTACCGTA

3'sequencing primers: primers designed according to sequence

 

pSilencer 2.1-U6-Neo Description

 This Ambion vector is for the expression of siRNA. It has an antibiotic resistance gene (neomycin) to enable selection of transfected cells and features the human RNA polymerase III promoter (U6). Sufficient reagents are provided for 20 reactions.

 

Caution:
Product is for research use only!

 

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart