pSP64- Tol2- Transposase Plasmid


  • Model: PVT1604
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pSP64-Tol2-Transposase,Plasmid pSP64-Tol2-Transposase,pSP64-Tol2-Transposase vector



pSP64-Tol2-Transposase Information

Promoter: SP6

Plasmid classification: mammalian cells, transposon vectors

Plasmid size: 5142bp

Prokaryotic resistance: Amp

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: sp6:ATTTAGGTGACACTATAGAA

Primers for 3'sequencing: primers designed based on sequences


pSP64-Tol2-Transposase Multiple site




pSP64-Tol2-Transposase Sequence

LOCUS       Exported                5142 bp ds-DNA     circular SYN 07-DEC-2015
DEFINITION  synthetic circular DNA
KEYWORDS    pSP64-Tol2-Transposase
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5142)
  AUTHORS   hp
  TITLE     Direct Submission
  JOURNAL   Exported Monday, September 5, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5142
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             28..2112
                     /note="transposase Tol2"
     misc_feature    5126..2
                     /note="SP6 promoter"
        1 gaatacaagc ttgggctgca ggtcgacatg ttcattggtc ctttggaagt gacgtcatgt
       61 cacatctatt accacaatgc acagcacctt gacctggaaa ttagggaaat tataacagtc
      121 aatcagtgga agaaaatgga ggaagtatgt gattcatcag cagctgcgag cagcacagtc
      181 caaaatcagc cacaggatca agagcacccg tggccgtatc ttcgcgaatt cttttcttta
      241 agtggtgtaa ataaagattc attcaagatg aaatgtgtcc tctgtctccc gcttaataaa
      301 gaaatatcgg ccttcaaaag ttcgccatca aacctaagga agcatattga gagaatgcac
      361 ccaaattacc tcaaaaacta ctctaaattg acagcacaga agagaaagat cgggacctcc
      421 acccatgctt ccagcagtaa gcaactgaaa gttgactcag ttttcccagt caaacatgtg
      481 tctccagtca ctgtgaacaa agctatatta aggtacatca ttcaaggact tcatcctttc
      541 agcactgttg atctgccatc atttaaagag ctgattagta cactgcagcc tggcatttct
      601 gtcattacaa ggcctacttt acgctccaag atagctgaag ctgctctgat catgaaacag
      661 aaagtgactg ctgccatgag tgaagttgaa tggattgcaa ccacaacgga ttgttggact
      721 gcacgtagaa agtcattcat tggtgtaact gctcactgga tcaaccctgg aagtcttgaa
      781 agacattccg ctgcacttgc ctgcaaaaga ttaatgggct ctcatacttt tgaggtactg
      841 gccagtgcca tgaatgatat ccactcagag tatgaaatac gtgacaaggt tgtttgcaca
      901 accacagaca gtggttccaa ctttatgaag gctttcagag tttttggtgt ggaaaacaat
      961 gatatcgaga ctgaggcaag aaggtgtgaa agtgatgaca ctgattctga aggctgtggt
     1021 gagggaagtg atggtgtgga attccaagat gcctcacgag tcctggacca agacgatggc
     1081 ttcgaattcc agctaccaaa acatcaaaag tgtgcctgtc acttacttaa cctagtctca
     1141 agcgttgatg cccaaaaagc tctctcaaat gaacactaca agaaactcta cagatctgtc
     1201 tttggcaaat gccaagcttt atggaataaa agcagccgat cggctctagc agctgaagct
     1261 gttgaatcag aaagccggct tcagctttta aggccaaacc aaacgcggtg gaattcaact
     1321 tttatggctg ttgacagaat tcttcaaatt tgcaaagaag caggagaagg cgcacttcgg
     1381 aatatatgca cctctcttga ggttccaatg tttaatccag cagaaatgct gttcttgaca
     1441 gagtgggcca acacaatgcg tccagttgca aaagtactcg acatcttgca agcggaaacg
     1501 aatacacagc tggggtggct gctgcctagt gtccatcagt taagcttgaa acttcagcga
     1561 ctccaccatt ctctcaggta ctgtgaccca cttgtggatg ccctacaaca aggaatccaa
     1621 acacgattca agcatatgtt tgaagatcct gagatcatag cagctgccat ccttctccct
     1681 aaatttcgga cctcttggac aaatgatgaa accatcataa aacgaggcat ggactacatc
     1741 agagtgcatc tggagccttt ggaccacaag aaggaattgg ccaacagttc atctgatgat
     1801 gaagattttt tcgcttcttt gaaaccgaca acacatgaag ccagcaaaga gttggatgga
     1861 tatctggcct gtgtttcaga caccagggag tctctgctca cgtttcctgc tatttgcagc
     1921 ctctctatca agactaatac acctcttccc gcatcggctg cctgtgagag gcttttcagc
     1981 actgcaggat tgcttttcag ccccaaaaga gctaggcttg acactaacaa ttttgagaat
     2041 cagcttctac tgaagttaaa tctgaggttt tacaactttg agggcggcgg caagaagaag
     2101 cgcaaggtgg gctagggatc cccgggcgag ctcccaaaaa aaaaaaaaaa aaaaaaaaaa
     2161 aaaaaccgaa ttctctagag gtaccccatg gctcgaggaa ttcgtaatca tgtcatagct
     2221 gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat
     2281 aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc
     2341 actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg
     2401 cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct
     2461 gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt
     2521 atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc
     2581 caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga
     2641 gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata
     2701 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac
     2761 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg
     2821 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc
     2881 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag
     2941 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt
     3001 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaagaacagt
     3061 atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg
     3121 atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac
     3181 gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca
     3241 gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac
     3301 ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac
     3361 ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt
     3421 tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt
     3481 accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt
     3541 atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc
     3601 cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa
     3661 tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg
     3721 tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt
     3781 gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc
     3841 agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt
     3901 aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg
     3961 gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac
     4021 tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc
     4081 gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt
     4141 tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg
     4201 aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
