pSPYNE-35S Plasmid

$260.00

  • Model: PVT15958
  • 20 Units in Stock
Ask a question


Add to Cart:

pSPYNE-35S Plasmid

PVT15958   2ug

 

pSPYNE-35S Plasmid Alternative Name
pSPYNE-35S Plasmid, pSPYNE-35S, pSPYNE-35S vector, pSPYNE-35S sequence, pSPYNE-35S map

 

pSPYNE-35S Plasmid Information

Promoter 35s

Prokaryotic resistance Kan

Screening marker G418

Clone strain DH5a

Culture Conditions LB/37 Celsius degree

Forward primer

Reverse primer

 

pSPYNE-35S Plasmid Description

pSPYNE-35S Plasmid is a Plant Reporting Plasmid

 

pSPYNE-35S Plasmid Sequence

TGAGCGTCGCAAAGGCGCTCGGTCTTGCCTTGCTCGTCGGTGATGTACTTCACCAGCTCCGCGAAGTCGCTCTTCTTGAT
GGAGCGCATGGGGACGTGCTTGGCAATCACGCGCACCCCCCGGCCGTTTTAGCGGCTAAAAAAGTCATGGCTCTGCCCTC
GGGCGGACCACGCCCATCATGACCTTGCCAAGCTCGTCCTGCTTCTCTTCGATCTTCGCCAGCAGGGCGAGGATCGTGGC
ATCACCGAACCGCGCCGTGCGCGGGTCGTCGGTGAGCCAGAGTTTCAGCAGGCCGCCCAGGCGGCCCAGGTCGCCATTGA
TGCGGGCCAGCTCGCGGACGTGCTCATAGTCCACGACGCCCGTGATTTTGTAGCCCTGGCCGACGGCCAGCAGGTAGGCC
GACAGGCTCATGCCGGCCGCCGCCGCCTTTTCCTCAATCGCTCTTCGTTCGTCTGGAAGGCAGTACACCTTGATAGGTGG
GCTGCCCTTCCTGGTTGGCTTGGTTTCATCAGCCATCCGCTTGCCCTCATCTGTTACGCCGGCGGTAGCCGGCCAGCCTC
GCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCT
ACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATA
TCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGG
GGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAG
GGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCG
AACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCAGAAGGCCGCCAGAGAGGCCGAGCGCGGCCGTG
AGGCTTGGACGCTAGGGCAGGGCATGAAAAAGCCCGTAGCGGGCTGCTACGGGCGTCTGACGCGGTGGAAAGGGGGAGGG
GATGTTGTCTACATGGCTCTGCTGTAGTGAGTGGGTTGCGCTCCGGCAGCGGTCCTGATCAATCGTCACCCTTTCTCGGT
CCTTCAACGTTCCTGACAACGAGCCTCCTTTTCGCCAATCCATCGACAATCACCGCGAGTCCCTGCTCGAACGCTGCGTC
CGGACCGGCTTCGTCGAAGGCGTCTATCGCGGCCCGCAACAGCGGCGAGAGCGGAGCCTGTTCAACGGTGCCGCCGCGCT
CGCCGGCATCGCTGTCGCCGGCCTGCTCCTCAAGCACGGCCCCAACAGTGAAGTAGCTGATTGTCATCAGCGCATTGACG
GCGTCCCCGGCCGAAAAACCCGCCTCGCAGAGGAAGCGAAGCTGCGCGTCGGCCGTTTCCATCTGCGGTGCGCCCGGTCG
CGTGCCGGCATGGATGCGCGCGCCATCGCGGTAGGCGAGCAGCGCCTGCCTGAAGCTGCGGGCATTCCCGATCAGAAATG
AGCGCCAGTCGTCGTCGGCTCTCGGCACCGAATGCGTATGATTCTCCGCCAGCATGGCTTCGGCCAGTGCGTCGAGCAGC
GCCCGCTTGTTCCTGAAGTGCCAGTAAAGCGCCGGCTGCTGAACCCCCAACCGTTCCGCCAGTTTGCGTGTCGTCAGACC
GTCTACGCCGACCTCGTTCAACAGGTCCAGGGCGGCACGGATCACTGTATTCGGCTGCAACTTTGTCATGCTTGACACTT
TATCACTGATAAACATAATATGTCCACCAACTTATCAGTGATAAAGAATCCGCGCGTTCAATCGGACCAGCGGAGGCTGG
TCCGGAGGCCAGACGTGAAACCCAACATACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGC
CTGATTATGCCGGTGCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCT
GGCGCTGTATGCGTTGGTGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCAATCT
TGCTCGTCTCGCTGGCCGGCGCCAGATCTGGGGAACCCTGTGGTTGGCATGCACATACAAATGGACGAACGGATAAACCT
TTTCACGCCCTTTTAAATATCCGATTATTCTAATAAACGCTCTTTTCTCTTAGGTTTACCCGCCAATATATCCTGTCAAA
CACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCG
CCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTC
TGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGC
AAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTC
AATCCAAATAATCTGCACCGGATCTGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTT
GGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCG
CAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATC
GTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGG
GCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGG
CGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGAT
GGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCA
AGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGC
CGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATAT
TGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCG
CCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGC
CATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATG
ATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACGGGATCTCTGCGGAACAGGCGGTCGAAGGTGCCGATAT
CATTACGACAGCAACGGCCGACAAGCACAACGCCACGATCCTGAGCGACAATATGATCGGGCCCGGCGTCCACATCAACG
GCGTCGGCGGCGACTGCCCAGGCAAGACCGAGATGCACCGCGATATCTTGCTGCGTTCGGATATTTTCGTGGAGTTCCCG
CCACAGACCCGGATGATCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGC
GATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGAT
GGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAA
TTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGCCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTG
GCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCT
GGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCT
ACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTT
CCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGAT
AATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGG
CCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAG
CGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCT
CGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGCATG
CCTGCAGGTCCCCAGATTAGCCTTTTCAATTTCAGAAAGAATGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGG
TCTCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAA
GATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATT
CAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCAT
GGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGAC
TCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTC
TCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTAT
CTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCG
TTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCA
ACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCA
AGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGGACTCTAGAGTTAACCGGGCTCAGGCCTG
GCGCGCCACTAGTGGATCCATCGATAGTACTGTCGACCTCGAGGGTACCGCTCCCGGGATGGAGCAAAAGTTGATTTCTG
AGGAGGATCTTATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTA
AACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCAC
CACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCGGCTACGGCCTGCAGTGCTTCGCCCGCTACCCCG
ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGAC
GACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGA
CTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCTAAG
AGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGAT
TATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTT
TTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCG
CGCGCGGTGTCATCTATGTTACTAGATCGGGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCG
TTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCT
TCCCAACAGTTGCGCAGCCTGAATGGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTC
CCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGAT
TTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAA
TAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGA
TTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCC
AGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCCAGTACATTAAAAACGTCCGCAA
TGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGCCACCAGCCAGCCAACAGCTCCCCGACC
GGCAGCTCGGCACAAAATCACCACTCGATACAGGCAGCCCATCAGTCCGGGACGGCGTCAGCGGGAGAGCCGTTGTAAGG
CGGCAGACTTTGCTCATGTTACCGATGCTATTCGGAAGAACGGCAACTAAGCTGCCGGGTTTGAAACACGGATGATCTCG
CGGAGGGTAGCATGTTGATTGTAACGATGACAGAGCGTTGCTGCCTGTGATCAAATATCATCTCCCTCGCAGAGATCCGA
ATTATCAGCCTTCTTATTCATTTCTCGCTTAACCGTGACAGGCTGTCGATCTTGAGAACTATGCCGACATAATAGGAAAT
CGCTGGATAAAGCCGCTGAGGAAGCTGAGTGGCGCTATTTCTTTAGAAGTGAACGTTGACGATATCAACTCCCCTATCCA
TTGCTCACCGAATGGTACAGGTCGGGGACCCGAAGTTCCGACTGTCGGCCTGATGCATCCCCGGCTGATCGACCCCAGAT
CTGGGGCTGAGAAAGCCCAGTAAGGAAACAACTGTAGGTTCGAGTCGCGAGATCCCCCGGAACCAAAGGAAGTAGGTTAA
ACCCGCTCCGATCAGGCCGAGCCACGCCAGGCCGAGAACATTGGTTCCTGTAGGCATCGGGATTGGCGGATCAAACACTA
AAGCTACTGGAACGAGCAGAAGTCCTCCGGCCGCCAGTTGCCAGGCGGTAAAGGTGAGCAGAGGCACGGGAGGTTGCCAC
TTGCGGGTCAGCACGGTTCCGAACGCCATGGAAACCGCCCCCGCCAGGCCCGCTGCGACGCCGACAGGATCTAGCGCTGC
GTTTGGTGTCAACACCAACAGCGCCACGCCCGCAGTTCCGCAAATAGCCCCCAGGACCGCCATCAATCGTATCGGGCTAC
CTAGCAGAGCGGCAGAGATGAACACGACCATCAGCGGCTGCACAGCGCCTACCGTCGCCGCGACCCCGCCCGGCAGGCGG
TAGACCGAAATAAACAACAAGCTCCAGAATAGCGAAATATTAAGTGCGCCGAGGATGAAGATGCGCATCCACCAGATTCC
CGTTGGAATCTGTCGGACGATCATCACGAGCAATAAACCCGCCGGCAACGCCCGCAGCAGCATACCGGCGACCCCTCGGC
CTCGCTGTTCGGGCTCCACGAAAACGCCGGACAGATGCGCCTTGTGAGCGTCCTTGGGGCCGTCCTCCTGTTTGAAGACC
GACAGCCCAATGATCTCGCCGTCGATGTAGGCGCCGAATGCCACGGCATCTCGCAACCGTTCAGCGAACGCCTCCATGGG
CTTTTTCTCCTCGTGCTCGTAAACGGACCCGAACATCTCTGGAGCTTTCTTCAGGGCCGACAATCGGATCTCGCGGAAAT
CCTGCACGTCGGCCGCTCCAAGCCGTCGAATCTGAGCCTTAATCACAATTGTCAATTTTAATCCTCTGTTTATCGGCAGT
TCGTAGAGCGCGCCGTGCGTCCCGAGCGATACTGAGCGAAGCAAGTGCGTCGAGCAGTGCCCGCTTGTTCCTGAAATGCC
AGTAAAGCGCTGGCTGCTGAACCCCCAGCCGGAACTGACCCCACAAGGCCCTAGCGTTTGCAATGCACCAGGTCATCATT
GACCCAGGCGTGTTCCACCAGGCCGCTGCCTCGCAACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCACGC
GGGTGGAATCCGATCCGCACATGAGGCGGAAGGTTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAGCTGAAATAGTCG
AACATCCGTCGGGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGTAGTGGTCGCCAGCAAACAGCAC
GACGATTTCCTCGTCGATCAGGACCTGGCAACGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGGTGCAGCAGCG
ACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCCTGTAGGCGCGACAGGCATTCCTCGGCC
TTCGTGTAATACCGGCCATTGATCGACCAGCCCAGGTCCTGGCAAAGCTCGTAGAACGTGAAGGTGATCGGCTCGCCGAT
AGGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACACCAGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGG
TGATCTTCACGTCCTTGTTGACGTGGAAAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGGTG
AACAGGGCAGAGCGGGCCGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTG
CATTTCCTTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTGCCAGGTCCTCGC
CGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCATCGACTTCGCCAAACCTGCCGCCTCCTGT
TCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCGGGCAGGGCAGGGGGAGCCAGTTGCACGCTGTCGCGCTCGAT
CTTGGCCGTAGCTTGCTGGACCATCGAGCCGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGA
TGGTTTCGGCATCCTCGGCGGAAAACCCCGCGTCGATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATT
CACCCTCCTTGCGGGATTGCCCCGACTCACGCCGGGGCAATGTGCCCTTATTCCTGATTTGACCCGCCTGGTGCCTTGGT
GTCCAGATAATCCACCTTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACTTGGTATTCCGAA
TCTTGCCCTGCACGAATACCAGCGACCCCTTGCCCAAATACTTGCCGTGGGCCTCGGCCTGAGAGCCAAAACACTTGATG
CGGAAGAAGTCGGTGCGCTCCTGCTTGTCGCCGGCATCGTTGCGCCACATCTAGGTACTAAAACAATTCATCCAGTAAAA
TATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATA
TCCTCCCTGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCC
ACTTACTTTGCCATCTTTCACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTT
CCGTCTTTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGGCC
AGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGAT
GGAGTGAAAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGC
AAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGGAACAGGC
AGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCAT
TTTTAAATATAGGTTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGC
GGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGT
ATTTAAAGATACCCCAAGAAGCTAATTATAACAAGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATAC
CAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCACAATT
ATGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTGTCTATCAGCT
GTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCAC
TGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCAT
GAATGGCGTTGGATGCCGGGCAACAGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAG
GCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATG
TCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGTCTCCGGAAGACGGTTGTTGCGCACGTATTCGGT
GAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTG
GCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACC
TGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTC
ATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCCAATTATGATAGAATTTACAAGCTATAAG
GTTATTGTCCTGGGTTTCAAGCATTAGTCCATGCAAGTTTTTATGCTTTGCCCATTCTATAGATATATTGATAAGCGCGC
TGCCTATGCCTTGCCCCCTGAAATCCTTACATACGGCGATATCTTCTATATAAAAGATATATTATCTTATCAGTATTGTC
AATATATTCAAGGCAATCTGCCTCCTCATCCTCTTCATCCTCTTCGTCTTGGTAGCTTTTTAAATATGGCGCTTCATAGA
GTAATTCTGTAAAGGTCCAATTCTCGTTTTCATACCTCGGTATAATCTTACCTATCACCTCAAATGGTTCGCTGGGTTTA
TCGCACCCCCGAACACGAGCACGGCACCCGCGACCACTATGCCAAGAATGCCCAAGGTAAAAATTGCCGGCCCCGCCATG
AAGTCCGTGAATGCCCCGACGGCCGAAGTGAAGGGCAGGCCGCCACCCAGGCCGCCGCCCTCACTGCCCGGCACCTGGTC
GCTGAATGTCGATGCCAGCACCTGCGGCACGTCAATGCTTCCGGGCGTCGCGCTCGGGCTGATCGCCCATCCCGTTACTG
CCCCGATCCCGGCAATGGCAAGGACTGCCAGCGCTGCCATTTTTGGGGTGAGGCCGTTCGCGGCCGAGGGGCGCAGCCCC
TGGGGGGATGGGAGGCCCGCGTTAGCGGGCCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACG
CGCACAGGGCGCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGCGGTGG
CCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTGGACAGCCCCTCAAATGTCAATAGGTGCGCCCC
TCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTGTCAGTAGTCGCGCCCCTCAAGTGTCAAT
ACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCATCTGTGGGAAACTCGCGTAAAATCAGGCGTTTTCGCCGATTTGC
GAGGCTGGCCAGCTCCACGTCGCCGGCCGAAATCGAGCCTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCC
TCAAGTGTCAACGTCCGCCCCTCATCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGCGGT
GTCTCGCACACGGCTTCGACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCCAGCGGCGAGGGCAACC
AGCCCGG

//

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart