pSUMO- mut

$260.00

  • Model: PVT10667
  • 50 Units in Stock
Ask a question


Add to Cart:

pSUMO-mut

PVT10667  2ug

 

pSUMO- mut Description

1. Carries the cspA low temperature induction promoter, 11 degrees low temperature induction, promotes the protein dissolution, increases the soluble protein probability.

2. carrying SUMO fusion protein to form a three level space structure helps to form the correct folding structure of the protein.

3. SUMO enzyme specifically cleavage fusion protein, recombinant protein N segment without amino acid residues.

4. resistance Kan

 

F Primer  AGATTCTTGTACGACGGTATTAG
R Primer  TAGTTATTGCTCAGCGGTGG

 

pSUMO-mut-vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart