pSV2- DHFR Plasmid


  • Model: PVT1031
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1031 2ug

pSV2-DHFR plasmid informaiton

Promoter: SV 40
Replicon: PMB1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: mammalian cell carrier; protein overexpression plasmid
Plasmid size: 4900bp
Plasmid label: C-DHFR (mouse DHFR)
Prokaryotic resistance: ampicillin Amp
Screening markers: methotrexate MTX
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: mammalian cells
Culture conditions: 37 centigrade, aerobic, LB
5'sequencing primers: SV40pro-F: TATTTATGCAGAGGCCGAGG
3'sequencing primers: SV40pA-R: GAAATTTGTGATGCTATTGC
Remarks: the pSV2-DHFR vector contains the DHFR gene of mice. At the same time, it is a shuttle plasmid of mammalian cells and Escherichia coli. In DHFR cell line, the transfected cells can be screened by methotrexate.

pSV2-DHFR plasmid Sequence

LOCUS       Exported                4976 bp ds-DNA     circular SYN 27-DEC-2018

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4976)

  AUTHORS   Triple Threat

  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..4976

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        10..339

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     rep_origin      190..325

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     CDS             438..1001


                     /gene="Mus musculus Dhfr"

                     /product="mouse dihydrofolate reductase"






     intron          1158..1223

                     /note="small t intron"

                     /note="simian virus 40 (SV40) small t antigen intron"

     CDS             1353..1373


                     /product="nuclear localization signal of SV40 large T 


                     /note="SV40 NLS"


     polyA_signal    1798..1932

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     promoter        2785..2889


                     /note="AmpR promoter"

     CDS             2890..3750





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      3921..4509



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     misc_feature    4695..4835


                     /note="basis of mobility region from pBR322"


        1 ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagc aggcagaagt

       61 atgcaaagca tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc aggctcccca

      121 gcaggcagaa gtatgcaaag catgcatctc aattagtcag caaccatagt cccgccccta

      181 actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc ccatggctga

      241 ctaatttttt ttatttatgc agaggccgag gccgcctcgg cctctgagct attccagaag

      301 tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa agcttggggg gggggacagc

      361 tcagggctgc gatttcgcgc caaacttgac ggcaatccta gcgtgaaggc tggtaggatt

      421 ttatccccgc tgccatcatg gttcgaccat tgaactgcat cgtcgccgtg tcccaaaata

      481 tggggattgg caagaacgga gacctaccct ggcctccgct caggaacgag ttcaagtact

      541 tccaaagaat gaccacaacc tcttcagtgg aaggtaaaca gaatctggtg attatgggta

      601 ggaaaacctg gttctccatt cctgagaaga atcgaccttt aaaggacaga attaatatag

      661 ttctcagtag agaactcaaa gaaccaccac gaggagctca ttttcttgcc aaaagtttgg

      721 atgatgcctt aagacttatt gaacaaccgg aattggcaag taaagtagac atggtttgga

      781 tagtcggagg cagttctgtt taccaggaag ccatgaatca accaggccac ctcagactct

      841 ttgtgacaag gatcatgcag gaatttgaaa gtgacacgtt tttcccagaa attgatttgg

      901 ggaaatataa acttctccca gaatacccag gcgtcctctc tgaggtccag gaggaaaaag

      961 gcatcaagta taagtttgaa gtctacgaga agaaagacta acaggaagat gctttcaagt

     1021 tctctgctcc cctcctaaag ctatgcattt ttataagacc atgggacttt tgctggcttt

     1081 agatctttgt gaaggaacct tacttctgtg gtgtgacata attggacaaa ctacctacag

     1141 agatttaaag ctctaaggta aatataaaat ttttaagtgt ataatgtgtt aaactactga

     1201 ttctaattgt ttgtgtattt tagattccaa cctatggaac tgatgaatgg gagcagtggt

     1261 ggaatgcctt taatgaggaa aacctgtttt gctcagaaga aatgccatct agtgatgatg

     1321 aggctactgc tgactctcaa cattctactc ctccaaaaaa gaagagaaag gtagaagacc

     1381 ccaaggactt tccttcagaa ttgctaagtt ttttgagtca tgctgtgttt agtaatagaa

     1441 ctcttgcttg ctttgctatt tacaccacaa aggaaaaagc tgcactgcta tacaagaaaa

     1501 ttatggaaaa atattctgta acctttataa gtaggcataa cagttataat cataacatac

     1561 tgttttttct tactccacac aggcatagag tgtctgctat taataactat gctcaaaaat

     1621 tgtgtacctt tagcttttta atttgtaaag gggttaataa ggaatatttg atgtatagtg

     1681 ccttgactag agatcataat cagccatacc acatttgtag aggttttact tgctttaaaa

     1741 aacctcccac acctccccct gaacctgaaa cataaaatga atgcaattgt tgttgttaac

     1801 ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat

     1861 aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat

     1921 catgtctgga tccccaggaa gctcctctgt gtcctcataa accctaacct cctctacttg

     1981 agaggacatt ccaatcatag gctgcccatc caccctctgt gtcctcctgt taattaggtc

     2041 acttaacaaa aaggaaattg ggtaggggtt tttcacagac cgctttctaa gggtaatttt

     2101 aaaatatctg ggaagtccct tccactgctg tgttccagaa gtgttggtaa acagcccaca

     2161 aatgtcaaca gcagaaacat acaagctgtc agctttgcac aagggcccaa caccctgctc

     2221 atcaagaagc actgtggttg ctgtgttagt aatgtgcaaa acaggaggca cattttcccc

     2281 acctgtgtag gttccaaaat atctagtgtt ttcattttta cttggatcag gaacccagca

     2341 ctccactgga taagcattat ccttatccaa aacagccttg tggtcagtgt tcatctgctg

     2401 actgtcaact gtagcatttt ttggggttac agtttgagca ggatatttgg tcctgtagtt

     2461 tgctaacaca ccctgcagct ccaaaggttc cccaccaaca gcaaaaaaat gaaaatttga

     2521 cccttgaatg ggttttccag caccattttc atgagttttt tgtgtccctg aatgcaagtt

     2581 taacatagca gttaccccaa taacctcagt tttaacagta acagcttccc acatcaaaat

     2641 atttccacag gttaagtcct catttaaatt aggcaaagga attcttgaag acgaaagggc

     2701 ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca

     2761 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat

     2821 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa

     2881 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt

     2941 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag

     3001 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt

     3061 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg

     3121 gtattatccc gtgttgacgc cgggcaagag caactcggtc gccgcataca ctattctcag

     3181 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta

     3241 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg

     3301 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta

     3361 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac

     3421 accacgatgc ctgcagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt

     3481 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca

     3541 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag

     3601 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta

     3661 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag

     3721 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt

     3781 tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat

     3841 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta

     3901 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa

     3961 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt

     4021 tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag

     4081 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta

     4141 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca

     4201 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag

     4261 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa

     4321 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga

     4381 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc

     4441 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc

     4501 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt

     4561 gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt

     4621 gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag

     4681 gaagcggaag agcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac

     4741 cgcatatggt gcactctcag tacaatctgc tctgatgccg catagttaag ccagtataca

     4801 ctccgctatc gctacgtgac tgggtcatgg ctgcgccccg acacccgcca acacccgctg

     4861 acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct

     4921 ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg aggcag


Search name

pSV2-DHFR,Plasmid pSV2-DHFR,pSV2-DHFR vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
