pSXneo 270 (T2AG3)

$193.00

  • Model: PVT10558
  • 49 Units in Stock
Ask a question


Add to Cart:

pSXneo 270(T2AG3)

Catalog No. PVT10558
Packing 2ug

 

pSXneo 270 (T2AG3) Information

Prokaryotic resistance: Amp

Eukaryotic resistance: G418

Clone strain: Stbl3

Culture condition: 37℃

Plasmid host: mammalian cell

Purpose of plasmid: protein expression

Fragment type: ORF

Fragment species:-

Prokaryotic resistance: Amp

Eukaryotic resistance: G418

Fluorescent labeling:-

 

pSXneo 270 (T2AG3) Description

pSXneo 270 (T2AG3)-vector

 

> SP6 5'-ATTTAGGTGACACTATAG-3'
ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTAACCCCAACCCCAACCCCAACCCCAACCCTAACCCTAACCCTAACCCCAACCGCAACCCTA
ACCCCAACCCCAACCCCAACCCTAACCCCAACCGCAACCCCAACCCCAACCCGAAGCCTAACCCTAACCC
TAACCCTAACCCGAACCCCAACC

//
 

Caution:
Product is for research use only!


        

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart