pTol2- Promoter- T2A- EGFP Plasmid


  • Model: PVT1603
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pTol2-Promoter-T2A-EGFP,Plasmid pTol2-Promoter-T2A-EGFP,pTol2-Promoter-T2A-EGFP vector



pTol2-Promoter-T2A-EGFP Information

Promoter: ZB-actin promoter

Replicator: pUC ori, F1 ori, SV40 ori

Plasmid classification: mammalian cells, transposon vectors

Plasmid size: 7312bp

Prokaryotic resistance: Kan

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: pEGFP-N-3:CGTCGCCGTCCAGCTCGACCAG

Primers for 3'sequencing: primers designed based on sequences



pTol2-Promoter-T2A-EGFP Cloning site




pTol2-Promoter-T2A-EGFP Sequence

LOCUS       Exported                7312 bp ds-DNA     circular SYN 07-DEC-2015
DEFINITION  synthetic circular DNA
KEYWORDS    pTol2-Promoter-T2A-EGFP
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7312)
  AUTHORS   hp
  TITLE     Direct Submission
  JOURNAL   Exported Monday, September 5, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..7312
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    12..233
                     /note="Tol2 5'end"
     promoter        262..2926
                     /note="ZB-actin promoter"
     enhancer        2851..2870
                     /note="PF2Asunbio primer"
     exon            2964..3044
     CDS             3051..3770
     misc_feature    4017..4217
                     /note="Tol2 3'end"
     rep_origin      4228..4683
                     /note="f1 ori"
     rep_origin      5024..5159
                     /note="SV40 ori"
     CDS             5208..6002
     rep_origin      6587..7230
                     /note="pUC ori"
        1 tagttattaa tagaggtgta aagtacttga gtaattttac ttgattactg tacttaagta
       61 ttatttttgg ggatttttac tttacttgag tacaattaaa aatcaatact tttactttta
      121 cttaattaca tttttttaga aaaaaaagta ctttttactc cttacaattt tatttacagt
      181 caaaaagtac ttattttttg gagatcactt cattctattt tcccttgcta ttagctagcg
      241 ctaccggact cagatctcga gcgtttactc tgagaaactt ccatatttta gaggtaaaat
      301 gctcagaatt gtaaaaagtc ttgtcaaaat acttggaatt tgccaaaaac aaaataaaag
      361 tcacatcacc tcattgtcct tggtatcagc aagcactttt aacacaatca gctgtttttg
      421 tttataactc ccactgaagg ccatgtgcat tactcccaag ttacacagta aaaagtcaca
      481 tgtagtttat catgatcact gctgctcaag cacagcttta tctgttattc agtgtggcaa
      541 tatctgaaat gtgtgcaaaa tattatttat tgtagctgat caccaacact ttcagtgttt
      601 tttttttcta cttttaatga gaattatgtt cttaggattt atccttataa acctctttaa
      661 aaagaaatgt tatgtctgca tagacacgac atgaaattat gaacagaaaa tttaactatt
      721 taagatcaag acttgacata taacatttct aatgaacatt aaacctgagg taggcccact
      781 tgcaaaaatg taactgctat cactcacttt atacatcatt gtgtaacttg tacacacaaa
      841 aatagtgaag caatgtggca tggaatgcag gtcccattca ttcaaagtta ttaaagcact
      901 ttcttaaagt gcattactac tgagctaaga ccagctagtt gctcatacaa catactacaa
      961 gtagtgtcat cctaatttgg ataaaaaaaa tgtccatttt atacatggaa aagtactcat
     1021 tagatccccc attgtttgta ttacggtatt tcgtgaacac aagaggtaaa tgacctacag
     1081 agctgctgtt gtgttagatt gaaaacacaa cacaggatca tggaggcatc catcattatg
     1141 acgcattctg ccacttgtaa ctctgcacag actttttgaa aagtttaatt gagtcttggc
     1201 gttgtcgcag aaaaatacga aaaattctgt gttaaaattt gcaaataaaa attccagttt
     1261 tataggaaat cgccatggcc ttgttcttta accagttaag cttccccttc tttcactctc
     1321 aagttgcaag aagcaagtgt agcaatgtgc acgcgacagc cgggtgtgtg acgctggacc
     1381 aatcagagca cagagctccg aaagtttacc ttttatggct agagccgggt atgtgccgtc
     1441 atataaaaga gcgcgcccag cttttcagcc tcactttgag ctcctccaca cgcagctagt
     1501 gcggaatatc atctgcttgt aacccattct cttaagtcga caacccccca aacccaaggt
     1561 gagttggttt tacagttttt aagcgtttaa ttatagtttc tatctattaa tgttaagtaa
     1621 aatgtgtaaa tggataaata tgatttgatg aagtctttag acagttcata acggtctctt
     1681 tgtagttatc tactaggttt gatttataag tggtggttct tttgataatc tatgttacat
     1741 ttaataaata ttggctgtat cttaactttt ttgtagcgtt agtggatgtg gcaggtgaga
     1801 atgtcggtaa tttaacgtga ccagtcgtag gcacgacatt gaacattgaa taggccggtg
     1861 tgaaatgggt gttaagtctt aatataaagt tgtgttctgg ctaatctctc tttaacagcc
     1921 ataaatgtga tttttaacta cagttttgag ggtgctggtg agcatgttgc acacttgatg
     1981 gatagccggc atgggaagtt ctttgtgcag gcagtgctgc agcagggtgt gacctacttt
     2041 agctagccgg ctaaccagct ctcatctgat gtaacgtaaa ccccatcaat ctaacatcgg
     2101 ctcattcgtg ctttataaga tcgaagatct tgttattagt aacgggtatt ggcatttagt
     2161 tttaacttgg ttaattttct ttttgttatg tgttctattt aaatgtagcc tgcagccccc
     2221 tctgtcttta atgaagctga agattaacgt taacgttagt gaagtgttgt atccgctatg
     2281 aaagatttga attttagagg tgtggtccac tttaataacg gctgcggagt tctctggctg
     2341 cacttcagcc gctgtgactg tcgaagcaga gcccatcagt ttttcaggat ctcggtgatt
     2401 tttgaggcta gactatgaac tgaaccgact gagagtgacc gtccagaaat gctttagtgt
     2461 gaagtctccg ctcacgagga gtccgtggac tgactgcaga tctgtgacgc agtaacaccc
     2521 ggcggcagac acccgttgaa atgcggttgt gtaattgatc gcaggcgagg gtggaagagg
     2581 atgtgaaact tcatttgtgt aaaatttagg gagtggtcct ggtgtgatga atgtcgaaat
     2641 ctgttccttt ttactgagcc ctacgactct ggctgagtgc cacaccgccg gcagccgcaa
     2701 agcggctcaa accattgcct tttatggtaa taatgagaga atgcagaggg acttcctttg
     2761 tctggcatat ctgaggcgcg cgctgtcact agcgcccacc agcggtcaga ctgtagaatg
     2821 cagagcaaaa caggaagttg actccagatg gtcacatgct tgctgaaacg cctctccctg
     2881 gcagcagtgc aattctaaca gtttcccttt cttttacagt tcagccgaat tctgcagtcg
     2941 acggtaccgc gggcccggga tccggaggtg gcagcggtgg cggtcagctg ttgaattttg
     3001 accttcttaa acttgcggga gacgtcgagt ccaaccctgg gcccacaacc atggtgagca
     3061 agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac ggcgacgtaa
     3121 acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac ggcaagctga
     3181 ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc ctcgtgacca
     3241 ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag cagcacgact
     3301 tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc ttcaaggacg
     3361 acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg gtgaaccgca
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
