pTrc99a Plasmid


  • Model: PVT0806
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pTrc99a,Plasmid pTrc99a,pTrc99a vector


pTrc99a Information

Promoter: Trc/lac
Replicon: pBR322 ori
Terminator: rrnB T2
Plasmid classification: Escherichia coli vector; pTrc series expression plasmid
Plasmid size: 4176bp
Prokaryotic resistance: ampicillin Amp
Cloned strain: Escherichia coli DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: Escherichia coli
Culture conditions: 37 centigrade, aerobic, LB
Inducement: IPTG or lactose and its analogues
5'sequencing primers: pTrcHis-F: GAGGTATATATTAATGTATCG
3'sequencing primers: pTrcHis-R:GATTTAATCTGTATCAGG
Remarks: pTrc expression plasmid


pTrc99a Description

PTrc99a is a pTrc series protein expression plasmid of Escherichia coli.


pTrcHis-F and pTrcHis-R sites

pTrc99a Sequence

LOCUS       Exported                4176 bp ds-DNA    circular SYN 11-9-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4176)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-9-11   

FEATURES             Location/Qualifiers
     source          1..4176
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    193..222
                     /note="trc promoter"
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac UV5 promoters"
     protein_bind    230..246
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    270..326
                     /note="pUC18/19 multiple cloning site"
     terminator      529..615
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      707..734
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        754..845
                     /note="AmpR promoter"
     CDS             846..1706
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1877..2465
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2651..2791
                     /note="basis of mobility region from pBR322"
     promoter        2977..3054
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3055..4137
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
        1 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc
       61 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc
      121 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc
      181 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga
      241 taacaatttc acacaggaaa cagaccatgg aattcgagct cggtacccgg ggatcctcta
      301 gagtcgacct gcaggcatgc aagcttggct gttttggcgg atgagagaag attttcagcc
      361 tgatacagat taaatcagaa cgcagaagcg gtctgataaa acagaatttg cctggcggca
      421 gtagcgcggt ggtcccacct gaccccatgc cgaactcaga agtgaaacgc cgtagcgccg
      481 atggtagtgt ggggtctccc catgcgagag tagggaactg ccaggcatca aataaaacga
      541 aaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc
      601 ctgagtagga caaatccgcc gggagcggat ttgaacgttg cgaagcaacg gcccggaggg
      661 tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa ttaagcagaa ggccatcctg
      721 acggatggcc tttttgcgtt tctacaaact ctttttgttt atttttctaa atacattcaa
      781 atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga
      841 agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc
      901 ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg
      961 gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc
     1021 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat
     1081 tatcccgtgt tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg
     1141 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag
     1201 aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
