pTrcHis A

$280.00

  • Model: PVTY01184
  • 20 Units in Stock
Ask a question


Add to Cart:

pTrcHis A

PVTY01184  2ug

pTrcHis A Description

Alias: pTrcHisA Plasmid type: E.coli Expression Vector Copy number: High copy Promoter: Trc Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4414 bp 5' Sequencing primers and sequences: pTrcHis-F: gaggtatatattaatgtatcg 3' Sequencing primers and sequences: pTrcHis-R:GATTTAATCTGTATCAGG Tags: N-His, N-Xpress Resistance(s): Ampicillin (Amp)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart