pTrcHisA Plasmid


  • Model: PVT0807
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pTrcHisA,Plasmid pTrcHisA,pTrcHisA vector


pTrcHisA Information

Promoter: Trc/lac

Replicon: PBR322 ori

Terminator: rrnB T2

Plasmid classification: Escherichia coli vector; pTrc series expression plasmid

Plasmid size: 4414bp

Plasmid label: N-His, N-EK, N-Xpress

Prokaryotic resistance: ampicillin Amp

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pTrcHis-F: GAGGTATATATTAATGTATCG

3'sequencing primers: pTrcHis-R:GATTTAATCTGTATCAGG

Remarks: pTrc expression plasmid


pTrcHisA Description

pTrcHis vector is an expression vector derived from pBR322 plasmids and is designed to express and purify the recombinant protein in Escherichia coli. The Trc promoter and rrnB anti termination region on the vector make high level protein expression possible..Trc promoter is composed of -35 region of Trp promoter and -10 region of Lac promoter. The pTrcHis vector also contains a LacIq gene that encodes the inhibitory protein of the Lac promoter. The presence of LacIq gene makes the host bacteria LacIq+ or LacIq- effectively inhibit the transcription of the inserting genes. When protein expression is expressed, Escherichia coli needs to grow to logarithmic growth period and then add 1mM IPTG to remove repressor protein and induce expression. The carrier of pTrcHis on the carrier is an expression vector derived from pBR322 plasmid, which is designed to express and purify the recombinant protein in Escherichia coli. The Trc promoter and rrnB anti termination region on the vector make high level protein expression possible..Trc promoter is composed of -35 region of Trp promoter and -10 region of Lac promoter. The pTrcHis vector also contains a LacIq gene that encodes the inhibitory protein of the Lac promoter. The presence of LacIq gene makes the host bacteria LacIq+ or LacIq- effectively inhibit the transcription of the inserting genes. When protein expression is expressed, Escherichia coli needs to grow to logarithmic growth period and then add 1mM IPTG to remove repressor protein and induce expression. The mini CIS trans substructure on the carrier can enhance the transcriptional level of the insertion gene, thus expressing the target protein at a high level. The DNA Fragment Expression Vector fragment located in the upper reaches of the downstream, there is a N- terminal fusion polypeptide sequence, the sequence contains ATG start codon, 6xHis tags, T7 phage 10 gene translation enhancer X, press epitope, mini cistron structure enterokinase recognition site, can enhance transcription of the inserted genes, thus high level expression of target protein. The DNA insertion fragment is located at the downstream of the expression vector, and there is a N- terminal fusion expression polypeptide sequence on the upstream. The sequence contains ATG initiation codon, 6xHis tag, T7 X 10 gene enhancer, X press epitope and enteric kinase enzyme recognition site.




pTrcHisA Sequqence

LOCUS       Exported                4414 bp ds-DNA     circular SYN 29-July-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4414)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-7-29 from SnapGene Viewer 2.8.1
FEATURES             Location/Qualifiers
     source          1..4414
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    193..222
                     /note="trc promoter"
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac UV5 promoters"
     protein_bind    230..246
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    263..332
                     /note="rrnG antiterminator"
                     /note="antiterminator from the E. coli rrnG leader region
                     (Berg et al., 1989)"
     CDS             383..409
                     /product="synthetic cistron containing a ribosome binding
                     site (Shine-Dalgarno sequence), for enhancing the bacterial
                     expression of a downstream cistron (Schoner, 1997)"
                     /note="This first cistron should terminate 3 bp upstream of
                     the ATG for the second cistron."
     CDS             425..442
                     /product="6xHis affinity tag"
     CDS             446..478
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     CDS             482..505
                     /product="Xpress(TM) epitope tag, including an enterokinase
                     recognition and cleavage site"
                     /note="Xpress(TM) tag"
     misc_feature    515..564
     terminator      767..853
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      945..972
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        992..1083
                     /note="AmpR promoter"
     CDS             1084..1944
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2115..2703
                     /note="ColE1 ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2889..3029
                     /note="basis of mobility region from pBR322"
     promoter        3215..3292
                     /note="lacI promoter"
     CDS             3293..4375

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
