pTrcHisA Plasmid


  • Model: PVT0807
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0807       2ug


pTrcHisA Information

Promoter: Trc/lac

Replicon: PBR322 ori

Terminator: rrnB T2

Plasmid classification: Escherichia coli vector; pTrc series expression plasmid

Plasmid size: 4414bp

Plasmid label: N-His, N-EK, N-Xpress

Prokaryotic resistance: ampicillin Amp

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pTrcHis-F: GAGGTATATATTAATGTATCG

3'sequencing primers: pTrcHis-R:GATTTAATCTGTATCAGG

Remarks: pTrc expression plasmid


pTrcHisA Description

pTrcHis  is an expression vector derived from pBR322 plasmids and is designed to express and purify the recombinant protein in Escherichia coli. The Trc promoter and rrnB anti termination region on the vector make high level protein expression possible..Trc promoter is composed of -35 region of Trp promoter and -10 region of Lac promoter. The pTrcHis vector also contains a LacIq gene that encodes the inhibitory protein of the Lac promoter. The presence of LacIq gene makes the host bacteria LacIq+ or LacIq- effectively inhibit the transcription of the inserting genes. When protein expression is expressed, Escherichia coli needs to grow to logarithmic growth period and then add 1mM IPTG to remove repressor protein and induce expression. The carrier of pTrcHis on the carrier is an expression vector derived from pBR322 plasmid, which is designed to express and purify the recombinant protein in Escherichia coli. The Trc promoter and rrnB anti termination region on the vector make high level protein expression possible..Trc promoter is composed of -35 region of Trp promoter and -10 region of Lac promoter. The pTrcHis vector also contains a LacIq gene that encodes the inhibitory protein of the Lac promoter. The presence of LacIq gene makes the host bacteria LacIq+ or LacIq- effectively inhibit the transcription of the inserting genes. When protein expression is expressed, Escherichia coli needs to grow to logarithmic growth period and then add 1mM IPTG to remove repressor protein and induce expression. The mini CIS trans substructure on the carrier can enhance the transcriptional level of the insertion gene, thus expressing the target protein at a high level. The DNA Fragment Expression Vector fragment located in the upper reaches of the downstream, there is a N- terminal fusion polypeptide sequence, the sequence contains ATG start codon, 6xHis tags, T7 phage 10 gene translation enhancer X, press epitope, mini cistron structure enterokinase recognition site, can enhance transcription of the inserted genes, thus high level expression of target protein. The DNA insertion fragment is located at the downstream of the expression vector, and there is a N- terminal fusion expression polypeptide sequence on the upstream. The sequence contains ATG initiation codon, 6xHis tag, T7 X 10 gene enhancer, X press epitope and enteric kinase enzyme recognition site.




pTrcHisA Sequqence

LOCUS       Exported                4414 bp ds-DNA     circular SYN 29-JUL-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4414)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-7-29 from SnapGene Viewer 2.8.1
FEATURES             Location/Qualifiers
     source          1..4414
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    193..222
                     /note="trc promoter"
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac UV5 promoters"
     protein_bind    230..246
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    263..332
                     /note="rrnG antiterminator"
                     /note="antiterminator from the E. coli rrnG leader region
                     (Berg et al., 1989)"
     CDS             383..409
                     /product="synthetic cistron containing a ribosome binding
                     site (Shine-Dalgarno sequence), for enhancing the bacterial
                     expression of a downstream cistron (Schoner, 1997)"
                     /note="This first cistron should terminate 3 bp upstream of
                     the ATG for the second cistron."
     CDS             425..442
                     /product="6xHis affinity tag"
     CDS             446..478
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     CDS             482..505
                     /product="Xpress(TM) epitope tag, including an enterokinase
                     recognition and cleavage site"
                     /note="Xpress(TM) tag"
     misc_feature    515..564
     terminator      767..853
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      945..972
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        992..1083
                     /note="AmpR promoter"
     CDS             1084..1944
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2115..2703
                     /note="ColE1 ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2889..3029
                     /note="basis of mobility region from pBR322"
     promoter        3215..3292
                     /note="lacI promoter"
     CDS             3293..4375
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
        1 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc
       61 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc
      121 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc
      181 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga
      241 taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa
      301 caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta
      361 aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa ccatgggggg
      421 ttctcatcat catcatcatc atggtatggc tagcatgact ggtggacagc aaatgggtcg
      481 ggatctgtac gacgatgacg ataaggatcg atggggatcc gagctcgaga tctgcagctg
      541 gtaccatatg ggaattcgaa gcttggctgt tttggcggat gagagaagat tttcagcctg
      601 atacagatta aatcagaacg cagaagcggt ctgataaaac agaatttgcc tggcggcagt
      661 agcgcggtgg tcccacctga ccccatgccg aactcagaag tgaaacgccg tagcgccgat
      721 ggtagtgtgg ggtctcccca tgcgagagta gggaactgcc aggcatcaaa taaaacgaaa
      781 ggctcagtcg aaagactggg cctttcgttt tatctgttgt ttgtcggtga acgctctcct
      841 gagtaggaca aatccgccgg gagcggattt gaacgttgcg aagcaacggc ccggagggtg
      901 gcgggcagga cgcccgccat aaactgccag gcatcaaatt aagcagaagg ccatcctgac
      961 ggatggcctt tttgcgtttc tacaaactct ttttgtttat ttttctaaat acattcaaat
     1021 atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag
     1081 agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt
     1141 cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt
     1201 gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc
     1261 cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta
     1321 tcccgtgttg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac
     1381 ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa
     1441 ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg
     1501 atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc
     1561 cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg
     1621 atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta
     1681 gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg
     1741 cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg
     1801 tctcgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc
     1861 tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt
     1921 gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt
     1981 gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc
     2041 atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag
     2101 atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa
     2161 aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg
     2221 aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag
     2281 ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg
     2341 ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga
     2401 tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc
     2461 ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc
     2521 acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga
     2581 gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt
     2641 cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg
     2701 aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac
     2761 atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga
     2821 gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg
     2881 gaagagcgcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcata
     2941 tggtgcactc tcagtacaat ctgctctgat gccgcatagt taagccagta tacactccgc
     3001 tatcgctacg tgactgggtc atggctgcgc cccgacaccc gccaacaccc gctgacgcgc
     3061 cctgacgggc ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga
     3121 gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgaggcag cagatcaatt
     3181 cgcgcgcgaa ggcgaagcgg catgcattta cgttgacacc atcgaatggc gcaaaacctt
     3241 tcgcggtatg gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc
     3301 agtaacgtta tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt
     3361 ggtgaaccag gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc
     3421 ggagctgaat tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct
     3481 gattggcgtt gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat
     3541 taaatctcgc gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg
     3601 cgtcgaagcc tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat
     3661 cattaactat ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt
     3721 tccggcgtta tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca
     3781 tgaagacggt acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc
     3841 gctgttagcg ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa
     3901 atatctcact cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat
     3961 gtccggtttt caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct
     4021 ggttgccaac gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg
     4081 cgttggtgcg gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat
     4141 cccgccgtca accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg
     4201 cttgctgcaa ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact
     4261 ggtgaaaaga aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc
     4321 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca
     4381 acgcaattaa tgtgagttag cgcgaattga tctg


Product is for research use only!


Search name

pTrcHisA,Plasmid pTrcHisA,pTrcHisA vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
