pTT5 Plasmid


  • Model: PVT1032
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pTT5,Plasmid pTT5,pTT5 vector

pTT5 Plasmid information

Promoter: CMV
Replicon: PMB1 ori
Terminator: beta globin poly (A) signal
Plasmid classification: mammalian cell carrier; protein over expression plasmid
Plasmid size: 4401bp
Prokaryotic resistance: ampicillin Amp
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expression host: mammalian cells
Culture conditions: 37, aerobic, LB
Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG
Primers for 3'sequencing: Based on sequence design


pTT5 Plasmid Sequence

LOCUS       Exported                4401 bp ds-DNA     
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4401)
  AUTHORS   Huanghua
  TITLE     Direct Submission
  JOURNAL   Exported 2016.09.08 from SnapGene Viewer 2.8.1
FEATURES             Location/Qualifiers
     source          1..4401
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        42..421
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        422..625
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     polyA_site      1277..1332
                     /note="beta-globin poly(A) signal"
                     /note="rabbit beta-globin polyadenylation signal"
     promoter        2501..2605
                     /note="AmpR promoter"
     CDS             2606..3466
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      3637..4225
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
        1 gtacatttat attggctcat gtccaatatg accgccatgt tgacattgat tattgactag
       61 ttattaatag taatcaatta cggggtcatt agttcatagc ccatatatgg agttccgcgt
      121 tacataactt acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc gcccattgac
      181 gtcaataatg acgtatgttc ccatagtaac gccaataggg actttccatt gacgtcaatg
      241 ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc atatgccaag
      301 tccgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg cccagtacat
      361 gaccttacgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat
      421 ggtgatgcgg ttttggcagt acaccaatgg gcgtggatag cggtttgact cacggggatt
      481 tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa atcaacggga
      541 ctttccaaaa tgtcgtaata accccgcccc gttgacgcaa atgggcggta ggcgtgtacg
      601 gtgggaggtc tatataagca gagctcgttt agtgaaccgt cagatcctca ctctcttccg
      661 catcgctgtc tgcgagggcc agctgttggg ctcgcggttg aggacaaact cttcgcggtc
      721 tttccagtac tcttggatcg gaaacccgtc ggcctccgaa cggtactccg ccaccgaggg
      781 acctgagcga gtccgcatcg accggatcgg aaaacctctc gagaaaggcg tctaaccagt
      841 cacagtcgca aggtaggctg agcaccgtgg cgggcggcag cgggtggcgg tcggggttgt
      901 ttctggcgga ggtgctgctg atgatgtaat taaagtaggc ggtcttgaga cggcggatgg
      961 tcgaggtgag gtgtggcagg cttgagatcc agctgttggg gtgagtactc cctctcaaaa
     1021 gcgggcatta cttctgcgct aagattgtca gtttccaaaa acgaggagga tttgatattc
     1081 acctggcccg atctggccat acacttgagt gacaatgaca tccactttgc ctttctctcc
     1141 acaggtgtcc actcccaggt ccaagtttaa acggatctct agcgaattcc ctctagaggg
     1201 cccgtttctg ctagcaagct tgctagcggc cgctcgaggc cggcaaggcc ggatcccccg
     1261 acctcgacct ctggctaata aaggaaattt attttcattg caatagtgtg ttggaatttt
     1321 ttgtgtctct cactcggaag gacatatggg agggcaaatc atttggtcga gatccctcgg
     1381 agatctctag ctagaggatc gatccccgcc ccggacgaac taaacctgac tacgacatct
     1441 ctgccccttc ttcgcggggc agtgcatgta atcccttcag ttggttggta caacttgcca
     1501 actgaaccct aaacgggtag catatgcttc ccgggtagta gtatatacta tccagactaa
     1561 ccctaattca atagcatatg ttacccaacg ggaagcatat gctatcgaat tagggttagt
     1621 aaaagggtcc taaggaacag cgatgtaggt gggcgggcca agataggggc gcgattgctg
     1681 cgatctggag gacaaattac acacacttgc gcctgagcgc caagcacagg gttgttggtc
     1741 ctcatattca cgaggtcgct gagagcacgg tgggctaatg ttgccatggg tagcatatac
     1801 tacccaaata tctggatagc atatgctatc ctaatctata tctgggtagc ataggctatc
     1861 ctaatctata tctgggtagc atatgctatc ctaatctata tctgggtagt atatgctatc
     1921 ctaatttata tctgggtagc ataggctatc ctaatctata tctgggtagc atatgctatc
     1981 ctaatctata tctgggtagt atatgctatc ctaatctgta tccgggtagc atatgctatc
     2041 ctaatagaga ttagggtagt atatgctatc ctaatttata tctgggtagc atatactacc
     2101 caaatatctg gatagcatat gctatcctaa tctatatctg ggtagcatat gctatcctaa
     2161 tctatatctg ggtagcatag gctatcctaa tctatatctg ggtagcatat gctatcctaa
     2221 tctatatctg ggtagtatat gctatcctaa tttatatctg ggtagcatag gctatcctaa
     2281 tctatatctg ggtagcatat gctatcctaa tctatatctg ggtagtatat gctatcctaa
     2341 tctgtatccg ggtagcatat gctatcctca tgataagctg tcaaacatga gaattaattc
     2401 ttgaagacga aagggcctcg tgatacgcct atttttatag gttaatgtca tgataataat
     2461 ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt
     2521 atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct
     2581 tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc
     2641 cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa
     2701 agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc tcaacagcgg
     2761 taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt
     2821 tctgctatgt ggcgcggtat tatcccgtgt tgacgccggg caagagcaac tcggtcgccg
     2881 catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac
     2941 ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg ataacactgc
     3001 ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt ttttgcacaa
     3061 catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg aagccatacc
     3121 aaacgacgag cgtgacacca cgatgcctgc agcaatggca acaacgttgc gcaaactatt
     3181 aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga
     3241 taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa
     3301 atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa
     3361 gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa
     3421 tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt
     3481 ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa ggatctaggt
     3541 gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
