pTWIN2 Plasmid


  • Model: PVT0833
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pTWIN2,Plasmid pTWIN2,pTWIN2 vector


pTWIN2 Information

Promoter: T7

Replicon: M13 ori

Plasmid classification: Escherichia coli vector; protein expression plasmid

Plasmid size: 7192bp

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: Based on sequence design

Remarks: expression plasmids



pTWIN2 Description

pTWIN2 is an E. coli expression vector which can be used with the IMPACT? Kit. A polylinker in the vector is designed for the in-frame fusion of a target gene between the modified Ssp DnaB (2) and Mth RIR1 inteins (3). The presence of the chitin binding domain from Bacillus circulans (4,5) facilitates purification. pTWIN vectors are designed for protein purification or for the isolation of proteins with an N-terminal cysteine and/or a C-terminal thioester (1). The double-stranded vector is 7192 base pairs in length.



pTWIN2 Sequence

LOCUS       Exported                7192 bp ds-DNA     circular SYN 18-Sept-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7192)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-09-18 from SnapGene Viewer 2.8.1
FEATURES             Location/Qualifiers
     source          1..7192
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        35..139
                     /note="AmpR promoter"
     CDS             140..1000
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      complement(1042..1555)
                     /note="M13 ori"
                     /note="M13 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     rep_origin      1666..2254
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2623..2814)
                     /product="Rop protein, which maintains plasmids at low copy
     CDS             complement(3371..4453)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4454..4531)
                     /note="lacI promoter"
     terminator      4684..4770
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      4867..4953
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      5050..5136
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      5233..5319
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      5416..5502
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     promoter        5637..5655
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     protein_bind    5656..5680
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
