pTXB1-Tn5

$580.00

  • Model: PVT12233
  • 20 Units in Stock
Ask a question


Add to Cart:

pTXB1-Tn5

PVT12233    2ug
 

pTXB1-Tn5 Information

Promoter: T7

Replicon: pUC

Prokaryotic resistance: Amp

Clonal strain: DH5a

Culture conditions: LB/37 Centigrade

Plasmid properties

Vector host: Escherichia coli

Carrier usage: Protein expression

Gene species: Escherichia coli

Gene type: ORF

Prokaryotic resistance: Amp

 

pTXB1-Tn5 Sequence

ATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGG
CTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCA
TCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGCAGCGATTCACAGATGTCTGCCTGTTCATC
CGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTT
CCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATG
CTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCG
GCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCCGAACGCCAGCAAGACGTAGCCCAGCGCGTCGGCCGCCATGC
CGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATT
CCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGC
CGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGA
AGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATT
GCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAG
AGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCC
TGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGG
CGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGG
TAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATT
TGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAG
ATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGAC
CCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCA
GAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTT
AATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCA
TCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCC
AGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAG
CTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCT
GATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCC
GGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACT
CCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCCGGCATGCC
GCCCTTTCGTCTTCAAGAATTAATTCCCAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTT
TCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGC
AACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTAATTCCCCAGGCATCAAATAAAACGAAAG
GCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGG
AGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTAATTCC
CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC
CTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCC
ATAAACTGCCAGGAATTAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCT
GTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGA
GGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTAATTCCCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAA
AGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGA
ACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGAATTGGGGATCGGAATTAATT
CCCGGTTTAAACCGGGGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCC
CTCTAGAAATAATTTTGTTAACTTTAAGAAGGAGATATACATATGATTACCAGTGCACTGCATCGTGCGGCGGATTGGGC
GAAAAGCGTGTTTTCTAGTGCTGCGCTGGGTGATCCGCGTCGTACCGCGCGTCTGGTGAATGTTGCGGCGCAACTGGCCA
AATATAGCGGCAAAAGCATTACCATTAGCAGCGAAGGCAGCAAAGCCATGCAGGAAGGCGCGTATCGTTTTATTCGTAAT
CCGAACGTGAGCGCGGAAGCGATTCGTAAAGCGGGTGCCATGCAGACCGTGAAACTGGCCCAGGAATTTCCGGAACTGCT
GGCAATTGAAGATACCACCTCTCTGAGCTATCGTCATCAGGTGGCGGAAGAACTGGGCAAACTGGGTAGCATTCAGGATA
AAAGCCGTGGTTGGTGGGTGCATAGCGTGCTGCTGCTGGAAGCGACCACCTTTCGTACCGTGGGCCTGCTGCATCAAGAA
TGGTGGATGCGTCCGGATGATCCGGCGGATGCGGATGAAAAAGAAAGCGGCAAATGGCTGGCCGCTGCTGCAACTTCGCG
TCTGAGAATGGGCAGCATGATGAGCAACGTGATTGCGGTGTGCGATCGTGAAGCGGATATTCATGCGTATCTGCAAGATA
AACTGGCCCATAACGAACGTTTTGTGGTGCGTAGCAAACATCCGCGTAAAGATGTGGAAAGCGGCCTGTATCTGTATGAT
CACCTGAAAAACCAGCCGGAACTGGGCGGCTATCAGATTAGCATTCCGCAGAAAGGCGTGGTGGATAAACGTGGCAAACG
TAAAAACCGTCCGGCGCGTAAAGCGAGCCTGAGCCTGCGTAGCGGCCGTATTACCCTGAAACAGGGCAACATTACCCTGA
ACGCGGTGCTGGCCGAAGAAATTAATCCGCCGAAAGGCGAAACCCCGCTGAAATGGCTGCTGCTGACCAGCGAGCCGGTG
GAAAGTCTGGCCCAAGCGCTGCGTGTGATTGATATTTATACCCATCGTTGGCGCATTGAAGAATTTCACAAAGCGTGGAA
AACGGGTGCGGGTGCGGAACGTCAGCGTATGGAAGAACCGGATAACCTGGAACGTATGGTGAGCATTCTGAGCTTTGTGG
CGGTGCGTCTGCTGCAACTGCGTGAATCTTTTACTCCGCCGCAAGCACTGCGTGCGCAGGGCCTGCTGAAAGAAGCGGAA
CACGTTGAAAGCCAGAGCGCGGAAACCGTGCTGACCCCGGATGAATGCCAACTGCTGGGCTATCTGGATAAAGGCAAACG
CAAACGCAAAGAAAAAGCGGGCAGCCTGCAATGGGCGTATATGGCGATTGCGCGTCTGGGCGGCTTTATGGATAGCAAAC
GTACCGGCATTGCGAGCTGGGGTGCGCTGTGGGAAGGTTGGGAAGCGCTGCAAAGCAAACTGGATGGCTTTCTGGCCGCG
AAAGACCTGATGGCGCAGGGCATTAAAATCTGCATCACGGGAGATGCACTAGTTGCCCTACCCGAGGGCGAGTCGGTACG
CATCGCCGACATCGTGCCGGGTGCGCGGCCCAACAGTGACAACGCCATCGACCTGAAAGTCCTTGACCGGCATGGCAATC
CCGTGCTCGCCGACCGGCTGTTCCACTCCGGCGAGCATCCGGTGTACACGGTGCGTACGGTCGAAGGTCTGCGTGTGACG
GGCACCGCGAACCACCCGTTGTTGTGTTTGGTCGACGTCGCCGGGGTGCCGACCCTGCTGTGGAAGCTGATCGACGAAAT
CAAGCCGGGCGATTACGCGGTGATTCAACGCAGCGCATTCAGCGTCGACTGTGCAGGTTTTGCCCGCGGGAAACCCGAAT
TTGCGCCCACAACCTACACAGTCGGCGTCCCTGGACTGGTGCGTTTCTTGGAAGCACACCACCGAGACCCGGACGCCCAA
GCTATCGCCGACGAGCTGACCGACGGGCGGTTCTACTACGCGAAAGTCGCCAGTGTCACCGACGCCGGCGTGCAGCCGGT
GTATAGCCTTCGTGTCGACACGGCAGACCACGCGTTTATCACGAACGGGTTCGTCAGCCACGCTACTGGCCTCACCGGTC
TGAACTCAGGCCTCACGACAAATCCTGGTGTATCCGCTTGGCAGGTCAACACAGCTTATACTGCGGGACAATTGGTCACA
TATAACGGCAAGACGTATAAATGTTTGCAGCCCCACACCTCCTTGGCAGGATGGGAACCATCCAACGTTCCTGCCTTGTG
GCAGCTTCAATGACTGCAGGAAGGGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTG
AGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGA
TAACTACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCG
TGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATG
CTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTCCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGA
GCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATG
GCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCT
GAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTG
GCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACT
GGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGAC
AGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTACCCCGGTTGATAATCAGAAAAGCCCCAAAAACAGGAAGATTGTATAAGCAAATATTTAAATTGTAAACGTTAATATT
TTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAA
ATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCA
ACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCG
AGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGC
GAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCA
CACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAA
AATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTT
TTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCA
ACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCA
CCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATA
AGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGC
ACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCC
CGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAA
ACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGG
CGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTT
TCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGA
CCGAGCGCAGCGAGTCAGTGAGCGAGGAAGctatggtgcactctcagtacaatctgctctgatgccgcatagttaagcca
gt

//

 

Caution:
1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.
 

pTXB1-Tn5 Search name

pTXB1-Tn5,pTXB1-Tn5 vector,pTXB1-Tn5 plasmid,pTXB1-Tn5 map

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart