pTYB1 Plasmid


  • Model: PVT0820
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pTYB1,Plasmid pTYB1,pTYB1 vector

pTYB1 Plasmid informaiton

Promoter: T7
Replicon: M13 ori
Plasmid classification: Escherichia coli vector; protein expression plasmid
Plasmid size: 7477bp
Plasmid label: Intein
Prokaryotic resistance: ampicillin Amp
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: Escherichia coli
Culture conditions: 37 centigrade, aerobic, LB
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: Based on sequence design
Remarks: expression plasmids

pTYB1 Plasmid Description
The pTYB1 is an E. coli vector created for fusion protein expression and purification. A target gene can be inserted into the the ORF by use of the MCS upstream of the Sce VMA intein. The NdeI site in the MCS has the initiator sequence ATG that enables translation of the ORF. The chitin-binding domain(CBD) downstream of the intein results in a target protein-intein with C-terminal chitin beads that facilitate protein purification. Release of the protein is induced by the thiol cleavage activity of the intein.

pTYB1 Plasmid Sequence
LOCUS       pTYB1 7477 bp  DNA SYN
  ORGANISM  other sequences; artificial sequences; vectors.
FEATURES             Location/Qualifiers
     source          1..7477
                     /mol_type="other DNA"
     promoter        70..98
     gene            140..1000
     CDS             140..1000
                     /label="ORF frame 2"
     rep_origin      complement(1232..1538)
     rep_origin      1650..2269
     misc_feature    2607..2629
     misc_feature    complement(2623..2814)
     CDS             2953..3588
                     /label="ORF frame 1"
     gene            complement(3010..3309)
                     /label="tet (611 - 312)"
                     /gene="tet (611 - 312)"
     misc_feature    complement(3371..4462)
     CDS             complement(3371..4330)
                     /label="ORF frame 1"
     CDS             complement(4654..5415)
                     /label="ORF frame 2"
     terminator      4687..4730
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
