
  • Model: PVT11201
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11201
Packing 2ug


pUC-SPYCE(M) Informaiton

Function plant reporter plasmid

Promoter: CaMV 35S promoter

Plasmid classification: plant BIFC bimolecular fluorescent plasmids

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence


pUC-SPYCE(M) Description
PUC-SPYCE is a plant BIFC bimolecular fluorescent plasmid.




pUC-SPYCE(M) Sequence

LOCUS       Exported                4140 bp ds-DNA     circular SYN 04-JAN-2018

DEFINITION  synthetic circular DNA

FEATURES             Location/Qualifiers

     source          1..4140

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        863..1208

                     /label=CaMV 35S promoter

                     /note="strong constitutive promoter from cauliflower mosaic


     misc_feature    1217..1300


     CDS             1304..1330


                     /product="HA (human influenza hemagglutinin) epitope tag"



     CDS             1331..1582


                     /product="C-terminal fragment of mVenus for use in 

                     bimolecular fluorescence complementation (BiFC) (Kodama and

                     Hu, 2010)"




     terminator      1602..1854

                     /label=NOS terminator

                     /note="nopaline synthase terminator and poly(A) signal"

     promoter        2353..2457


                     /label=AmpR promoter

     CDS             2458..3318





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      3489..4077



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 



        1 tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat

       61 accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag

      121 cgcccaatac gcaaaccgcc tctccccgcg cgttggccga ttcattaatg cagctggcac

      181 gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc

      241 actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt

      301 gtgagcggat aacaatttca cacaggaaac agctatgacc atgattacgc caagcttgca

      361 tgcctgcagg tccccagatt agccttttca atttcagaaa gaatgctaac ccacagatgg

      421 ttagagaggc ttacgcagca ggtctcatca agacgatcta cccgagcaat aatctccagg

      481 aaatcaaata ccttcccaag aaggttaaag atgcagtcaa aagattcagg actaactgca

      541 tcaagaacac agagaaagat atatttctca agatcagaag tactattcca gtatggacga

      601 ttcaaggctt gcttcacaaa ccaaggcaag taatagagat tggagtctct aaaaaggtag

      661 ttcccactga atcaaaggcc atggagtcaa agattcaaat agaggaccta acagaactcg

      721 ccgtaaagac tggcgaacag ttcatacaga gtctcttacg actcaatgac aagaagaaaa

      781 tcttcgtcaa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag

      841 tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc

      901 tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg

      961 gctcctacaa atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg

     1021 acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc

     1081 caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg

     1141 cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg

     1201 agagaacacg ggggactcta gagttaaccg ggctcaggcc tggcgcgcca ctagtggatc

     1261 catcgatagt actgtcgacc tcgagggtac cgctcccggg atgtacccat acgatgttcc

     1321 agattacgct gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat

     1381 cgaggacggc agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg

     1441 ccccgtgctg ctgcccgaca accactacct gagctaccag tccaagctga gcaaagaccc

     1501 caacgagaag cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct

     1561 cggcatggac gagctgtaca agtaagagct cgaatttccc cgatcgttca aacatttggc

     1621 aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc

     1681 tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat

     1741 gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat

     1801 agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat

     1861 tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat

     1921 cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat

     1981 cgcccttccc aacagttgcg cagcctgaat ggcgaatggc gcctgatgcg gtattttctc

     2041 cttacgcatc tgtgcggtat ttcacaccgc atatggtgca ctctcagtac aatctgctct

     2101 gatgccgcat agttaagcca gccccgacac ccgccaacac ccgctgacgc gccctgacgg

     2161 gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg gagctgcatg

     2221 tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgagac gaaagggcct cgtgatacgc

     2281 ctatttttat aggttaatgt catgataata atggtttctt agacgtcagg tggcactttt

     2341 cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat

     2401 ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg

     2461 agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt

     2521 tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga

     2581 gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa

     2641 gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt

     2701 attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt

     2761 gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc

     2821 agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga

     2881 ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat

     2941 cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct

     3001 gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc

     3061 cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg

     3121 gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc

     3181 ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg

     3241 acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca

     3301 ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta

     3361 aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc

     3421 aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa

     3481 ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca

     3541 ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta

     3601 actggcttca gcagagcgca gataccaaat actgttcttc tagtgtagcc gtagttaggc

     3661 caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca

     3721 gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta

     3781 ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag

     3841 cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt

     3901 cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc

     3961 acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac

     4021 ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac

     4081 gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
