
  • Model: PVT11201
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11201
Packing 2ug


pUC-SPYCE(M) Informaiton

Function plant reporter plasmid

Promoter: CaMV 35S promoter

Plasmid classification: plant BIFC bimolecular fluorescent plasmids

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence


pUC-SPYCE(M) Description
PUC-SPYCE is a plant BIFC bimolecular fluorescent plasmid.




pUC-SPYCE(M) Sequence

LOCUS       Exported                4140 bp ds-DNA     circular SYN 01-DEC-2017
DEFINITION  synthetic circular DNA
FEATURES             Location/Qualifiers
     source          1..4140
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     protein_bind    225..246
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        261..291
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    299..315
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     323..339
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     promoter        863..1208
                     /note="CaMV 35S promoter"
                     /note="strong constitutive promoter from cauliflower mosaic
     misc_feature    1217..1300
     CDS             1304..1330
                     /product="HA (human influenza hemagglutinin) epitope tag"
     misc_feature    1331..1585
     terminator      1602..1854
                     /note="NOS terminator"
                     /note="nopaline synthase terminator and poly(A) signal"
     primer_bind     complement(1863..1879)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar 
     promoter        2353..2457
                     /note="AmpR promoter"
     CDS             2458..3318
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      3489..4077
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat
       61 accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag
      121 cgcccaatac gcaaaccgcc tctccccgcg cgttggccga ttcattaatg cagctggcac
      181 gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc
      241 actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt
      301 gtgagcggat aacaatttca cacaggaaac agctatgacc atgattacgc caagcttgca
      361 tgcctgcagg tccccagatt agccttttca atttcagaaa gaatgctaac ccacagatgg
      421 ttagagaggc ttacgcagca ggtctcatca agacgatcta cccgagcaat aatctccagg
      481 aaatcaaata ccttcccaag aaggttaaag atgcagtcaa aagattcagg actaactgca
      541 tcaagaacac agagaaagat atatttctca agatcagaag tactattcca gtatggacga
      601 ttcaaggctt gcttcacaaa ccaaggcaag taatagagat tggagtctct aaaaaggtag
      661 ttcccactga atcaaaggcc atggagtcaa agattcaaat agaggaccta acagaactcg
      721 ccgtaaagac tggcgaacag ttcatacaga gtctcttacg actcaatgac aagaagaaaa
      781 tcttcgtcaa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag
      841 tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc
      901 tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg
      961 gctcctacaa atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg
     1021 acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc
     1081 caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg
     1141 cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg
     1201 agagaacacg ggggactcta gagttaaccg ggctcaggcc tggcgcgcca ctagtggatc
     1261 catcgatagt actgtcgacc tcgagggtac cgctcccggg atgtacccat acgatgttcc
     1321 agattacgct gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat
     1381 cgaggacggc agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg
     1441 ccccgtgctg ctgcccgaca accactacct gagctaccag tccgccctga gcaaagaccc
     1501 caacgagaag cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct
     1561 cggcatggac gagctgtaca agtaagagct cgaatttccc cgatcgttca aacatttggc
     1621 aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc
     1681 tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat
     1741 gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat
     1801 agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat
     1861 tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat
     1921 cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat
     1981 cgcccttccc aacagttgcg cagcctgaat ggcgaatggc gcctgatgcg gtattttctc
     2041 cttacgcatc tgtgcggtat ttcacaccgc atatggtgca ctctcagtac aatctgctct
     2101 gatgccgcat agttaagcca gccccgacac ccgccaacac ccgctgacgc gccctgacgg
     2161 gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg gagctgcatg
     2221 tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgagac gaaagggcct cgtgatacgc
     2281 ctatttttat aggttaatgt catgataata atggtttctt agacgtcagg tggcactttt
     2341 cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat
     2401 ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg
     2461 agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt
     2521 tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga
     2581 gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa
     2641 gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt
     2701 attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt
     2761 gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc
     2821 agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga
     2881 ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat
     2941 cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct
     3001 gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc
     3061 cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg
     3121 gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
