
  • Model: PVT11197
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11197
Packing 2ug


pUC-SPYNE Information

Function plant reporter plasmid

Promoter: CaMV 35S promoter

Plasmid classification: plant series plasmid; plant report plasmid; dual fluorescent plasmid

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence


pUC-SPYNE Description

PUC-SPYNE plasmids are bipartite fluorescent plasmids.



pUC-SPYNE Sequence

LOCUS       Exported                4356 bp ds-DNA     circular SYN 08-NOV-2017

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4356)

FEATURES             Location/Qualifiers

     source          1..4356

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     primer_bind     complement(1..9)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     promoter        483..587


                     /note="AmpR promoter"

     CDS             588..1448





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      1619..2207



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     protein_bind    2495..2516

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        2531..2561

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    2569..2585

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     2593..2609

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     promoter        3133..3478

                     /note="CaMV 35S promoter"

                     /note="strong constitutive promoter from cauliflower mosaic


     misc_feature    3487..3570


     CDS             3574..3603


                     /product="Myc (human c-Myc oncogene) epitope tag"



     CDS             3604..4071






     terminator      4088..4340

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     primer_bind     complement(4349..4356)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 



        1 tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag

       61 cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc

      121 aacagttgcg cagcctgaat ggcgaatggc gcctgatgcg gtattttctc cttacgcatc

      181 tgtgcggtat ttcacaccgc atatggtgca ctctcagtac aatctgctct gatgccgcat

      241 agttaagcca gccccgacac ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc

      301 tcccggcatc cgcttacaga caagctgtga ccgtctccgg gagctgcatg tgtcagaggt

      361 tttcaccgtc atcaccgaaa cgcgcgagac gaaagggcct cgtgatacgc ctatttttat

      421 aggttaatgt catgataata atggtttctt agacgtcagg tggcactttt cggggaaatg

      481 tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga

      541 gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac

      601 atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc

      661 cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca

      721 tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc

      781 caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg

      841 ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac

      901 cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca

      961 taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg

     1021 agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac

     1081 cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg

     1141 caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat

     1201 taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg

     1261 ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg

     1321 cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc

     1381 aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc

     1441 attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt

     1501 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt

     1561 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt

     1621 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag

     1681 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca

     1741 gcagagcgca gataccaaat actgttcttc tagtgtagcc gtagttaggc caccacttca

     1801 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg

     1861 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg

     1921 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct

     1981 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga

     2041 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc

     2101 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg

     2161 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg

     2221 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt

     2281 tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc

     2341 gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcccaatac

     2401 gcaaaccgcc tctccccgcg cgttggccga ttcattaatg cagctggcac gacaggtttc

     2461 ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc actcattagg

     2521 caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat

     2581 aacaatttca cacaggaaac agctatgacc atgattacgc caagcttgca tgcctgcagg

     2641 tccccagatt agccttttca atttcagaaa gaatgctaac ccacagatgg ttagagaggc

     2701 ttacgcagca ggtctcatca agacgatcta cccgagcaat aatctccagg aaatcaaata

     2761 ccttcccaag aaggttaaag atgcagtcaa aagattcagg actaactgca tcaagaacac

     2821 agagaaagat atatttctca agatcagaag tactattcca gtatggacga ttcaaggctt

     2881 gcttcacaaa ccaaggcaag taatagagat tggagtctct aaaaaggtag ttcccactga

     2941 atcaaaggcc atggagtcaa agattcaaat agaggaccta acagaactcg ccgtaaagac

     3001 tggcgaacag ttcatacaga gtctcttacg actcaatgac aagaagaaaa tcttcgtcaa

     3061 catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag tctcagaaga

     3121 ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc tcggattcca

     3181 ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg gctcctacaa

     3241 atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg acagtggtcc

     3301 caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc caaccacgtc

     3361 ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg cacaatccca

     3421 ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg agagaacacg

     3481 ggggactcta gagttaaccg ggctcaggcc tggcgcgcca ctagtggatc catcgatagt

     3541 actgtcgacc tcgagggtac cgctcccggg atggagcaaa agttgatttc tgaggaggat

     3601 cttatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct ggtcgagctg

     3661 gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg cgatgccacc

     3721 tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt gccctggccc

     3781 accctcgtga ccaccttcgg ctacggcctg cagtgcttcg cccgctaccc cgaccacatg

     3841 aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga gcgcaccatc

     3901 ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga gggcgacacc

     3961 ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa catcctgggg

     4021 cacaagctgg agtacaacta caacagccac aacgtctata tcatggccta agagctcgaa

     4081 tttccccgat cgttcaaaca tttggcaata aagtttctta agattgaatc ctgttgccgg

     4141 tcttgcgatg attatcatat aatttctgtt gaattacgtt aagcatgtaa taattaacat

     4201 gtaatgcatg acgttattta tgagatgggt ttttatgatt agagtcccgc aattatacat

     4261 ttaatacgcg atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt

     4321 gtcatctatg ttactagatc gggaattcac tggccg


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
