pUC35s- RAT5- a- mCherry

$215.00

  • Model: PVT11193
  • 50 Units in Stock
Ask a question


Add to Cart:

pUC35s-RAT5-a-mCherry

Catalog No. PVT11193
Packing 2ug

 

pUC35s-RAT5-a-mCherry  Information

Function plant reporter plasmid

Promoter: CaMV 35S promoter

Plasmid classification: plant series, protein overexpression vector

Prokaryotic resistance: Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart