pXMJ19

$260.00

  • Model: PVT11360
  • 48 Units in Stock
Ask a question


Add to Cart:

pXMJ19

Catalog No. PVT11360
Packing 2ug

 

pXMJ19 Information

Vector name: pXMJ19

Plasmid type: Corynebacterium glutamiens / Escherichia coli shuttle plasmid

Resistance Chl

Growth Strain  DH5α

Culture medium  LB

Temperature  37℃

High copy / low copy: -

Promoter: -

Cloning methods: polyclonal sites, restrictive endonucleases

Carrier size: 6601bp

5'sequencing primers and sequences: LacI-R: GGCATACTCTGCGACATCGT;

Tac promoter: GAGCGGATAACAATTTCACACAGG

3'sequencing primers and sequences: --

Carrier label: -

Carrier resistance: chloramphenicol

Screening markers: -

Note: -

Genbank: AJ133195.1

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart