pYD1

$193.00

  • Model: PVT11284
  • 46 Units in Stock
Ask a question


Add to Cart:

pYD1

Catalog No. PVT11284
Packing 2ug

 

pYD1 Information
Function yeast plasmids

Plasmid type: yeast expression display system carrier

High copy / low copy: high copy

Promoter: CMV

Cloning methods: polyclonal sites, restrictive endonucleases

Carrier size: 5009bp

5'sequencing primers and sequences: pYD1-F: AGTAACGTTTGTCAGTAATTGC

3'sequencing primers and sequences: pYD1-R: GTCGATTTTGTTACATCTACAC

Carrier label: C-His

Carrier resistance: ampicin

Screening markers: TRP1

Note: the Saccharomyces cerevisiae is EBY100.

Product directory number: V835-01

Stability: stable expression

Composition type: composition type

Virus / non virus: non virus

 

pYD1 Description

pYD1-vector


pYD1 Sequence

ACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTC
GCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGT
TATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATG
ATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGAT
ATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAAT
GTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCGGAC
TACTAGCAGCTGTAATACGACTCACTATAGGGAATATTAAGCTAATTCTACTTCATACATTTTCAATTAAGATGCAG
TTACTTCGCTGTTTTTCAATATTTTCTGTTATTGCTTCAGTTTTAGCACAGGAACTGACAACTATATGCGAGCAAAT
CCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTACTATTTTGGCCAACGGGAAGGCAATGCAAG
GAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACAACTAGCAAAGGCAGC
CCCATAAACACACAGTATGTTTTTAAGCTTCTGCAGGCTAGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGG
TGGTGGTTCTGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGTACCAGGAT
CCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCTTCGAAGGTAAGCCT
ATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTAAACCCGCTG
ATCTGATAACAACAGTGTAGATGTAACAAAATCGACTTTGTTCCCACTGTACTTTTAGCTCGTACAAAATACAATAT
ACTTTTCATTTCTCCGTAAACAACATGTTTTCCCATGTAATATCCTTTTCTATTTTTCGTTCCGTTACCAACTTTAC
ACATACTTTATATAGCTATTCACTTCTATACACTAAAAAACTAAGACAATTTTAATTTTGCTGCCTGCCATATTTCA
ATTTGTTATAAATTCCTATAATTTATCCTATTAGTAGCTAAAAAAAGATGAATGTGAATCGAATCCTAAGAGAATTG
GGCAAGTGCACAAACAATACTTAAATAAATACTACTCAGTAATAACCTATTTCTTAGCATTTTTGACGAAATTTGCT
ATTTTGTTAGAGTCTTTTACACCATTTGTCTCCACACCTCCGCTTACATCAACACCAATAACGCCATTTAATCTAAG
CGCATCACCAACATTTTCTGGCGTCAGTCCACCAGCTAACATAAAATGTAAGCTCTCGGGGCTCTCTTGCCTTCCAA
CCCAGTCAGAAATCGAGTTCCAATCCAAAAGTTCACCTGTCCCACCTGCTTCTGAATCAAACAAGGGAATAAACGAA
TGAGGTTTCTGTGAAGCTGCACTGAGTAGTATGTTGCAGTCTTTTGGAAATACGAGTCTTTTAATAACTGGCAAACC
GAGGAACTCTTGGTATTCTTGCCACGACTCATCTCCGTGCAGTTGGACGATATCAATGCCGTAATCATTGACCAGAG
CCAAAACATCCTCCTTAGGTTGATTACGAAACACGCCAACCAAGTATTTCGGAGTGCCTGAACTATTTTTATATGCT
TTTACAAGACTTGAAATTTTCCTTGCAATAACCGGGTCAATTGTTCTCTTTCTATTGGGCACACATATAATACCCAG
CAAGTCAGCATCGGAATCTAGAGCACATTCTGCGGCCTCTGTGCTCTGCAAGCCGCAAACTTTCACCAATGGACCAG
AACTACCTGTGAAATTAATAACAGACATACTCCAAGCTGCCTTTGTGTGCTTAATCACGTATACTCACGTGCTCAAT
AGTCACCAATGCCCTCCCTCTTGGCCCTCTCCTTTTCTTTTTTCGACCGAATTTCTTGAAGACGAAAGGGCCTCGTG
ATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGGACGGATCGCTTGCCTGTAACTTACACGC
GCCTCGTATCTTTTAATGATGGAATAATTTGGGAATTTACTCTGTGTTTATTTATTTTTATGTTTTGTATTTGGATT
TTAGAAAGTAAATAAAGAAGGTAGAAGAGTTACGGAATGAAGAAAAAAAAATAAACAAAGGTTTAAAAAATTTCAAC
AAAAAGCGTACTTTACATATATATTTATTAGACAAGAAAAGCAGATTAAATAGATATACATTCGATTAACGATAAGT
AAAATGTAAAATCACAGGATTTTCGTGTGTGGTCTTCTACACAGACAAGATGAAACAATTCGGCATTAATACCTGAG
AGCAGGAAGAGCAAGATAAAAGGTAGTATTTGTTGGCGATCCCCCTAGAGTCTTTTACATCTTCGGAAAACAAAAAC
TATTTTTTCTTTAATTTCTTTTTTTACTTTCTATTTTTAATTTATATATTTATATTAAAAAATTTAAATTATAATTA
TTTTTATAGCACGTGATGAAAAGGACCCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTT
TTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAA
GAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACC
CAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAAC
AGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGG
CGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTG
AGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATG
AGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACAT
GGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCA
CGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAA
TTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGC
TGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTA
TCGTAGTTATCTACACGACGGGCAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCA
CTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATT
TAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAG
CGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACA
AAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTT
CAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCAC
CGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTG
GACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGA
GCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGG
CGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGGAACGCCTGGTAT
CTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCCGAGCCT
ATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTG
CGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACC
GAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGAT
TCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTACC
TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCCTATGTTGTGTGGAATTGTGAGCGGATAACAA
TTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGGAATTAACCCTCACTAAAGGGAACAAAAGCTGGC
TAGT

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart