
  • Model: PVT4030
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4030  2ug

pYES2/ CT Information

Promoter: GAL1 promoter

Replicator: 2 ori, ori, FI ori

Terminator: CYC1

Plasmid size: 5963bp

Prokaryotic resistance: Amp

Screening markers: URA3

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: yeast cells

5'sequencing primers: GAL1-F: ATTTTCGGTTTGTATTACTTC


Use: Yeast expression


pYES2/ CT Description




pYES2/ CT Sequence

LOCUS       Exported                5963 bp ds-DNA     circular SYN 11-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 4

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5963)


  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..5963

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        2..443

                     /gene="S. cerevisiae GAL1"

                     /note="GAL1 promoter"

                     /note="inducible promoter, regulated by Gal4"

     protein_bind    2..119



                     /note="upstream activating sequence mediating 

                     Gal4-dependent induction"

     promoter        475..493

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     CDS             607..648


                     /product="epitope tag from simian virus 5"

                     /note="V5 tag"


     CDS             658..675


                     /product="6xHis affinity tag"



     terminator      709..956

                     /gene="S. cerevisiae CYC1"

                     /note="CYC1 terminator"

                     /note="transcription terminator for CYC1"

     rep_origin      complement(1204..1792)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(1963..2823)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     CDS             complement(2919..3722)


                     /gene="S. cerevisiae URA3"

                     /product="orotidine-5'-phosphate decarboxylase, required 

                     for uracil biosynthesis"


                     /note="yeast auxotrophic marker, counterselectable with 

                     5-fluoroorotic acid (5-FOA)"






     promoter        complement(3723..3938)

                     /gene="S. cerevisiae URA3"

                     /note="URA3 promoter"

     rep_origin      4542..5422

                     /note="2u ori"

                     /note="yeast 2u plasmid origin of replication"

     rep_origin      complement(5491..5946)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"


        1 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt

       61 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga

      121 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac

      181 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga

      241 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat

      301 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc

      361 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac

      421 ctctatactt taacgtcaag gagaaaaaac cccggatcgg actactagca gctgtaatac

      481 gactcactat agggaatatt aagcttggta ccgagctcgg atccactagt aacggccgcc

      541 agtgtgctgg aattctgcag atatccagca cagtggcggc cgctcgagtc tagagggccc

      601 ttcgaaggta agcctatccc taaccctctc ctcggtctcg attctacgcg taccggtcat

      661 catcaccatc accattgagt ttaaacccgc tgatcctaga gggccgcatc atgtaattag

      721 ttatgtcacg cttacattca cgccctcccc ccacatccgc tctaaccgaa aaggaaggag

      781 ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa

      841 cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca

      901 ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaaggcttta atttgcaagc

      961 tgcggccctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg

     1021 ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt

     1081 atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa

     1141 gaacatgtga gcaaaaggcc agcaaaagcc caggaaccgt aaaaaggccg cgttgctggc

     1201 gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag

     1261 gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt

     1321 gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg

     1381 aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg

     1441 ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg

     1501 taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac

     1561 tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg

     1621 gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt

     1681 taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg

     1741 tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc

     1801 tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt

     1861 ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt

     1921 taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag

     1981 tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt

     2041 cgtgtagata actacgatac gggagcgctt accatctggc cccagtgctg caatgatacc

     2101 gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc

     2161 cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg

     2221 ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg gcattgctac

     2281 aggcatcgtg gtgtcactct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg

     2341 atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc

     2401 tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact

     2461 gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc

     2521 aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat

     2581 acgggataat agtgtatcac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc

     2641 ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac

     2701 tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa

     2761 aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact

     2821 catactcttc ctttttcaat gggtaataac tgatataatt aaattgaagc tctaatttgt

     2881 gagtttagta tacatgcatt tacttataat acagtttttt agttttgctg gccgcatctt

     2941 ctcaaatatg cttcccagcc tgcttttctg taacgttcac cctctacctt agcatccctt

     3001 ccctttgcaa atagtcctct tccaacaata ataatgtcag atcctgtaga gaccacatca

     3061 tccacggttc tatactgttg acccaatgcg tctcccttgt catctaaacc cacaccgggt

     3121 gtcataatca accaatcgta accttcatct cttccaccca tgtctctttg agcaataaag

     3181 ccgataacaa aatctttgtc gctcttcgca atgtcaacag tacccttagt atattctcca

     3241 gtagataggg agcccttgca tgacaattct gctaacatca aaaggcctct aggttccttt

     3301 gttacttctt ctgccgcctg cttcaaaccg ctaacaatac ctgggcccac cacaccgtgt

     3361 gcattcgtaa tgtctgccca ttctgctatt ctgtatacac ccgcagagta ctgcaatttg

     3421 actgtattac caatgtcagc aaattttctg tcttcgaaga gtaaaaaatt gtacttggcg

     3481 gataatgcct ttagcggctt aactgtgccc tccatggaaa aatcagtcaa gatatccaca

     3541 tgtgttttta gtaaacaaat tttgggacct aatgcttcaa ctaactccag taattccttg

     3601 gtggtacgaa catccaatga agcacacaag tttgtttgct tttcgtgcat gatattaaat

     3661 agcttggcag caacaggact aggatgagta gcagcacgtt ccttatatgt agctttcgac

     3721 atgatttatc ttcgtttcct gcaggttttt gttctgtgca gttgggttaa gaatactggg

     3781 caatttcatg tttcttcaac actacatatg cgtatatata ccaatctaag tctgtgctcc

     3841 ttccttcgtt cttccttctg ttcggagatt accgaatcaa aaaaatttca aagaaaccga

     3901 aatcaaaaaa aagaataaaa aaaaaatgat gaattgaatt gaaaagctag cttatcgatg

     3961 ataagctgtc aaagatgaga attaattcca cggactatag actatactag atactccgtc

     4021 tactgtacga tacacttccg ctcaggtcct tgtcctttaa cgaggcctta ccactctttt

     4081 gttactctat tgatccagct cagcaaaggc agtgtgatct aagattctat cttcgcgatg

     4141 tagtaaaact agctagaccg agaaagagac tagaaatgca aaaggcactt ctacaatggc

     4201 tgccatcatt attatccgat gtgacgctgc agcttctcaa tgatattcga atacgctttg

     4261 aggagataca gcctaatatc cgacaaactg ttttacagat ttacgatcgt acttgttacc

     4321 catcattgaa ttttgaacat ccgaacctgg gagttttccc tgaaacagat agtatatttg

     4381 aacctgtata ataatatata gtctagcgct ttacggaaga caatgtatgt atttcggttc

     4441 ctggagaaac tattgcatct attgcatagg taatcttgca cgtcgcatcc ccggttcatt

     4501 ttctgcgttt ccatcttgca cttcaatagc atatctttgt taacgaagca tctgtgcttc

     4561 attttgtaga acaaaaatgc aacgcgagag cgctaatttt tcaaacaaag aatctgagct

     4621 gcatttttac agaacagaaa tgcaacgcga aagcgctatt ttaccaacga agaatctgtg

     4681 cttcattttt gtaaaacaaa aatgcaacgc gacgagagcg ctaatttttc aaacaaagaa

     4741 tctgagctgc atttttacag aacagaaatg caacgcgaga gcgctatttt accaacaaag

     4801 aatctatact tcttttttgt tctacaaaaa tgcatcccga gagcgctatt tttctaacaa

     4861 agcatcttag attacttttt ttctcctttg tgcgctctat aatgcagtct cttgataact

     4921 ttttgcactg taggtccgtt aaggttagaa gaaggctact ttggtgtcta ttttctcttc

     4981 cataaaaaaa gcctgactcc acttcccgcg tttactgatt actagcgaag ctgcgggtgc

     5041 attttttcaa gataaaggca tccccgatta tattctatac cgatgtggat tgcgcatact

     5101 ttgtgaacag aaagtgatag cgttgatgat tcttcattgg tcagaaaatt atgaacggtt

     5161 tcttctattt tgtctctata tactacgtat aggaaatgtt tacattttcg tattgttttc

     5221 gattcactct atgaatagtt cttactacaa tttttttgtc taaagagtaa tactagagat

     5281 aaacataaaa aatgtagagg tcgagtttag atgcaagttc aaggagcgaa aggtggatgg

     5341 gtaggttata tagggatata gcacagagat atatagcaaa gagatacttt tgagcaatgt

     5401 ttgtggaagc ggtattcgca atgggaagct ccaccccggt tgataatcag aaaagcccca

     5461 aaaacaggaa gattgtataa gcaaatattt aaattgtaaa cgttaatatt ttgttaaaat

     5521 tcgcgttaaa tttttgttaa atcagctcat tttttaacga atagcccgaa atcggcaaaa

     5581 tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttccaaca

     5641 agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaagg gtctatcagg

     5701 gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta

     5761 aagcagtaaa tcggaagggt aaacggatgc ccccatttag agcttgacgg ggaaagccgg

     5821 cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggggctagg gcggtgggaa

     5881 gtgtaggggt cacgctgggc gtaaccacca cacccgccgc gcttaatggg gcgctacagg

     5941 gcgcgtgggg atgatccact agt



Product is for research use only!


Search name

pYES2/CT,Plasmid pYES2/CT,pYES2/CT vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
