pYES2/ CT Plasmid


  • Model: PVT4030
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pYES2/CT,Plasmid pYES2/CT,pYES2/CT vector


pYES2/ CT Information

Promoter: GAL1 promoter

Replicator: 2 ori, ori, FI ori

Terminator: CYC1

Plasmid size: 5963bp

Prokaryotic resistance: Amp

Screening markers: URA3

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: yeast cells

5'sequencing primers: GAL1-F: ATTTTCGGTTTGTATTACTTC


Use: Yeast expression


pYES2/ CT Description




pYES2/ CT Sequence

LOCUS       Exported                5963 bp ds-DNA     circular SYN 11-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 4
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5963)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..5963
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        2..443
                     /gene="S. cerevisiae GAL1"
                     /note="GAL1 promoter"
                     /note="inducible promoter, regulated by Gal4"
     protein_bind    2..119
                     /note="upstream activating sequence mediating 
                     Gal4-dependent induction"
     promoter        475..493
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             607..648
                     /product="epitope tag from simian virus 5"
                     /note="V5 tag"
     CDS             658..675
                     /product="6xHis affinity tag"
     terminator      709..956
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(1204..1792)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(1963..2823)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     CDS             complement(2919..3722)
                     /gene="S. cerevisiae URA3"
                     /product="orotidine-5'-phosphate decarboxylase, required 
                     for uracil biosynthesis"
                     /note="yeast auxotrophic marker, counterselectable with 
                     5-fluoroorotic acid (5-FOA)"
     promoter        complement(3723..3938)
                     /gene="S. cerevisiae URA3"
                     /note="URA3 promoter"
     rep_origin      4542..5422
                     /note="2u ori"
                     /note="yeast 2u plasmid origin of replication"
     rep_origin      complement(5491..5946)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
        1 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt
       61 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga
      121 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac
      181 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga
      241 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat
      301 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc
      361 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac
      421 ctctatactt taacgtcaag gagaaaaaac cccggatcgg actactagca gctgtaatac
      481 gactcactat agggaatatt aagcttggta ccgagctcgg atccactagt aacggccgcc
      541 agtgtgctgg aattctgcag atatccagca cagtggcggc cgctcgagtc tagagggccc
      601 ttcgaaggta agcctatccc taaccctctc ctcggtctcg attctacgcg taccggtcat
      661 catcaccatc accattgagt ttaaacccgc tgatcctaga gggccgcatc atgtaattag
      721 ttatgtcacg cttacattca cgccctcccc ccacatccgc tctaaccgaa aaggaaggag
      781 ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa
      841 cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca
      901 ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaaggcttta atttgcaagc
      961 tgcggccctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg
     1021 ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt
     1081 atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
     1141 gaacatgtga gcaaaaggcc agcaaaagcc caggaaccgt aaaaaggccg cgttgctggc
     1201 gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
     1261 gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
