
  • Model: PVT11234
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT11234  2ug


pYES2 Description

Promoter: GAL1 promoter

Replicon: 2 ori, ori, FI ori

Terminator: CYC1 Terminator

Plasmid classification: yeast series plasmid; yeast expression plasmid; Saccharomyces cerevisiae plasmid

Plasmid size: 5856bp

Prokaryotic resistance: ampicillin Amp (100 g/ml)

Selection marker: URA3

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, LB, aerobic.

Expression host: INVSC1 and other Saccharomyces cerevisiae

Culture conditions: 30 C, YPD, aerobic.

5'sequencing primers: T7 (TAATACGACTCACTATAGGG)

3'sequencing primers: CYC1-Ter (GTGACATAACTAATTACATGATG)


pYES2 Information

PYES2 is a 5.9 KB vector designed to induce recombinant protein expression in Saccharomyces cerevisiae. The characteristics of the vector are that the construction of gene insertion vector is simple, and the prototrophic uracil can be used to screen the transformed strains.

1. The yeast GAL1 promoter can induce the expression of the target protein in Saccharomyces cerevisiae at a high level of galactose, and can be inhibited by glucose.

2. many restriction sites can be used by polyclonal sites to facilitate gene insertion.

3.CYC1 terminator can effectively terminate mRNA transcription.

4. it is possible to screen transformants of yeast host strains with URA3 genotype by using URA3 gene.

5. the ampicillin resistant gene can be used for carrier screening in E. coli.


 pYES2 is 5.9 kb vector respectively, designed for inducible expression of recombinant proteins in Saccharomyces cerevisiae. Features of the vectors allow purification and detection of expressed proteins (see pages 13–20 for more information). The vectors contain the following elements: Yeast GAL1 promoter for high level inducible protein expression in yeast by galactose and repression by glucose (Giniger et al., 1985; West et al., 1984) Multiple cloning site (MCS) with 8 or 9 unique sites (plus two BstX I sites) to facilitate in-frame cloning with the C-terminal peptide C-terminal peptide encoding the V5 epitope and a polyhistidine (6xHis) tag for detection and purification of your recombinant fusion protein 2μorigin for episomal maintenance and high copy replication (pYES2/CT and pYES3/CT) or CEN6/ARSH4 sequence for non-integrative centromeric maintenance and low copy replication (pYC2/CT) URA3 or TRP1 auxotrophic marker for selection of yeast transformants Ampicillin resistance gene for selection in E. coli.
         Use the following outline to clone and express your gene of interest in pYES2.
         • Consult the multiple cloning site described on page 3 to design a strategy to clone your gene in pYES2.
         • Ligate your insert into pYES2 and transform into E. coli. Select transformants on LB plates containing 50 to 100 µg/ml ampicillin.
         • Analyze your transformants for the presence of insert by restriction digestion.
         • Select a transformant with the correct restriction pattern and use sequencing to confirm that your gene is cloned in the proper orientation.
         • Transform your construct into competent INVSc1 cells and select for uracil prototrophy.
         • Test for expression of your recombinant gene by Western blot analysis or functional assay.


pYES2 Multiple Cloning site



pYES2 Sequence

LOCUS       Exported                5856 bp ds-DNA     circular SYN 07-FEB-2013

DEFINITION  High-copy episomal vector for galactose-inducible expression of 

            proteins in Saccharomyces cerevisiae.


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5856)

  AUTHORS   Invitrogen (Life Technologies)

  TITLE     Direct Submission

  JOURNAL   Exported Sunday, September 11, 2016

FEATURES             Location/Qualifiers

     source          1..5856

                     /organism="synthetic DNA construct"

                     /lab_host="Saccharomyces cerevisiae"

                     /mol_type="other DNA"

     promoter        2..443

                     /gene="S. cerevisiae GAL1"

                     /note="GAL1 promoter"

                     /note="inducible promoter, regulated by Gal4"

     protein_bind    2..119



                     /note="upstream activating sequence mediating 

                     Gal4-dependent induction"

     promoter        475..493

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     misc_feature    501..600


                     /note="multiple cloning site"

     terminator      609..856

                     /gene="S. cerevisiae CYC1"

                     /note="CYC1 terminator"

                     /note="transcription terminator for CYC1"

     rep_origin      complement(1097..1685)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(1856..2716)





                     /note="confers resistance fo ampicillin, carbenicillin, and

                     related antibiotics"







     CDS             complement(2812..3615)


                     /gene="S. cerevisiae URA3"

                     /product="orotidine-5'-phosphate decarboxylase, required 

                     for uracil biosynthesis"


                     /note="yeast auxotrophic marker, counterselectable with 

                     5-fluoroorotic acid (5-FOA)"






     promoter        complement(3616..3831)

                     /gene="S. cerevisiae URA3"

                     /note="URA3 promoter"

     rep_origin      4435..5315

                     /note="2u ori"

                     /note="yeast 2u plasmid origin of replication"

     rep_origin      complement(5384..5839)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"


        1 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt

       61 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga

      121 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac

      181 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga

      241 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat

      301 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc

      361 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac

      421 ctctatactt taacgtcaag gagaaaaaac cccggatcgg actactagca gctgtaatac

      481 gactcactat agggaatatt aagcttggta ccgagctcgg atccactagt aacggccgcc

      541 agtgtgctgg aattctgcag atatccatca cactggcggc cgctcgagca tgcatctaga

      601 gggccgcatc atgtaattag ttatgtcacg cttacattca cgccctcccc ccacatccgc

      661 tctaaccgaa aaggaaggag ttagacaacc tgaagtctag gtccctattt atttttttat

      721 agttatgtta gtattaagaa cgttatttat atttcaaatt tttctttttt ttctgtacag

      781 acgcgtgtac gcatgtaaca ttatactgaa aaccttgctt gagaaggttt tgggacgctc

      841 gaaggcttta atttgcggcc ctgcattaat gaatcggcca acgcgcgggg agaggcggtt

      901 tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc

      961 tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg

     1021 ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa gcccaggaac cgtaaaaagg

     1081 ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac

     1141 gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg

     1201 gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct

     1261 ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg

     1321 tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct

     1381 gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac

     1441 tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt

     1501 tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc

     1561 tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca

     1621 ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat

     1681 ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac

     1741 gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt

     1801 aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc

     1861 aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg

     1921 cctgactccc cgtcgtgtag ataactacga tacgggagcg cttaccatct ggccccagtg

     1981 ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc

     2041 cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta

     2101 ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg

     2161 ttggcattgc tacaggcatc gtggtgtcac tctcgtcgtt tggtatggct tcattcagct

     2221 ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta

     2281 gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg

     2341 ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga

     2401 ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt

     2461 gcccggcgtc aatacgggat aatagtgtat cacatagcag aactttaaaa gtgctcatca

     2521 ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt

     2581 cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt

     2641 ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga

     2701 aatgttgaat actcatactc ttcctttttc aatgggtaat aactgatata attaaattga

     2761 agctctaatt tgtgagttta gtatacatgc atttacttat aatacagttt tttagttttg

     2821 ctggccgcat cttctcaaat atgcttccca gcctgctttt ctgtaacgtt caccctctac

     2881 cttagcatcc cttccctttg caaatagtcc tcttccaaca ataataatgt cagatcctgt

     2941 agagaccaca tcatccacgg ttctatactg ttgacccaat gcgtctccct tgtcatctaa

     3001 acccacaccg ggtgtcataa tcaaccaatc gtaaccttca tctcttccac ccatgtctct

     3061 ttgagcaata aagccgataa caaaatcttt gtcgctcttc gcaatgtcaa cagtaccctt

     3121 agtatattct ccagtagata gggagccctt gcatgacaat tctgctaaca tcaaaaggcc

     3181 tctaggttcc tttgttactt cttctgccgc ctgcttcaaa ccgctaacaa tacctgggcc

     3241 caccacaccg tgtgcattcg taatgtctgc ccattctgct attctgtata cacccgcaga

     3301 gtactgcaat ttgactgtat taccaatgtc agcaaatttt ctgtcttcga agagtaaaaa

     3361 attgtacttg gcggataatg cctttagcgg cttaactgtg ccctccatgg aaaaatcagt

     3421 caagatatcc acatgtgttt ttagtaaaca aattttggga cctaatgctt caactaactc

     3481 cagtaattcc ttggtggtac gaacatccaa tgaagcacac aagtttgttt gcttttcgtg

     3541 catgatatta aatagcttgg cagcaacagg actaggatga gtagcagcac gttccttata

     3601 tgtagctttc gacatgattt atcttcgttt cctgcaggtt tttgttctgt gcagttgggt

     3661 taagaatact gggcaatttc atgtttcttc aacactacat atgcgtatat ataccaatct

     3721 aagtctgtgc tccttccttc gttcttcctt ctgttcggag attaccgaat caaaaaaatt

     3781 tcaaagaaac cgaaatcaaa aaaaagaata aaaaaaaaat gatgaattga attgaaaagc

     3841 tagcttatcg atgataagct gtcaaagatg agaattaatt ccacggacta tagactatac

     3901 tagatactcc gtctactgta cgatacactt ccgctcaggt ccttgtcctt taacgaggcc

     3961 ttaccactct tttgttactc tattgatcca gctcagcaaa ggcagtgtga tctaagattc

     4021 tatcttcgcg atgtagtaaa actagctaga ccgagaaaga gactagaaat gcaaaaggca

     4081 cttctacaat ggctgccatc attattatcc gatgtgacgc tgcagcttct caatgatatt

     4141 cgaatacgct ttgaggagat acagcctaat atccgacaaa ctgttttaca gatttacgat

     4201 cgtacttgtt acccatcatt gaattttgaa catccgaacc tgggagtttt ccctgaaaca

     4261 gatagtatat ttgaacctgt ataataatat atagtctagc gctttacgga agacaatgta

     4321 tgtatttcgg ttcctggaga aactattgca tctattgcat aggtaatctt gcacgtcgca

     4381 tccccggttc attttctgcg tttccatctt gcacttcaat agcatatctt tgttaacgaa

     4441 gcatctgtgc ttcattttgt agaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca

     4501 aagaatctga gctgcatttt tacagaacag aaatgcaacg cgaaagcgct attttaccaa

     4561 cgaagaatct gtgcttcatt tttgtaaaac aaaaatgcaa cgcgacgaga gcgctaattt

     4621 ttcaaacaaa gaatctgagc tgcattttta cagaacagaa atgcaacgcg agagcgctat

     4681 tttaccaaca aagaatctat acttcttttt tgttctacaa aaatgcatcc cgagagcgct

     4741 atttttctaa caaagcatct tagattactt tttttctcct ttgtgcgctc tataatgcag

     4801 tctcttgata actttttgca ctgtaggtcc gttaaggtta gaagaaggct actttggtgt

     4861 ctattttctc ttccataaaa aaagcctgac tccacttccc gcgtttactg attactagcg

     4921 aagctgcggg tgcatttttt caagataaag gcatccccga ttatattcta taccgatgtg

     4981 gattgcgcat actttgtgaa cagaaagtga tagcgttgat gattcttcat tggtcagaaa

     5041 attatgaacg gtttcttcta ttttgtctct atatactacg tataggaaat gtttacattt

     5101 tcgtattgtt ttcgattcac tctatgaata gttcttacta caattttttt gtctaaagag

     5161 taatactaga gataaacata aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc

     5221 gaaaggtgga tgggtaggtt atatagggat atagcacaga gatatatagc aaagagatac

     5281 ttttgagcaa tgtttgtgga agcggtattc gcaatgggaa gctccacccc ggttgataat

     5341 cagaaaagcc ccaaaaacag gaagattgta taagcaaata tttaaattgt aaacgttaat

     5401 attttgttaa aattcgcgtt aaatttttgt taaatcagct cattttttaa cgaatagccc

     5461 gaaatcggca aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt

     5521 ccagtttcca acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa

     5581 agggtctatc agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg

     5641 tcgaggtgcc gtaaagcagt aaatcggaag ggtaaacgga tgcccccatt tagagcttga

     5701 cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggggct

     5761 agggcggtgg gaagtgtagg ggtcacgctg ggcgtaacca ccacacccgc cgcgcttaat

     5821 ggggcgctac agggcgcgtg gggatgatcc actagt



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
