pYES2

$280.00

  • Model: PVTY01198
  • 20 Units in Stock
Ask a question


Add to Cart:

pYES2

PVTY01198  2ug

pYES2 Description

Plasmid type: Saccharomyces cerevisiae Expression vector Copy number: High copy Induction method: Galactose Promoter: GAL1 Cloning Method: Multiple cloning sites,restriction endonuclease Size: 5857 bp 5' Sequencing primers and sequences: T7: TAATACGACTCACTATAGGG 3' Sequencing primers and sequences: CYC1 Terminator: GTGACATAACTAATTACATGATG Resistance(s): Ampicillin (Amp) Selectable markers: URA3 Note: It is induced by galactose and expressed in Saccharomyces cerevisiae.

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart