
  • Model: PVT11237
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11237
Packing 2ug


pYES3/CT Information

Function yeast expression plasmid

Promoter: T7, GAL1, TRP1

Replicator: 2 ori, ori, FI ori

Terminator: CYC1

Plasmid classification: yeast series, Saccharomyces cerevisiae expression vector

Plasmid size: 5870bp

Prokaryotic resistance: Amp

Screening markers: TRP1

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Induction method: galactose induction

5'sequencing primers: GAL1-F: ATTTTCGGTTTGTATTACTTC



pYES3/CT Description

pYES3/CT and pYES6/CT are S. cerevisiae expression vectors derived from the parental pYES2 vector. Vectors feature a C-terminal V5 epitope for detection with an Anti-V5 Antibody. pYES3/CT carries the TRP1 selection marker for selection in yeast. pYES6/CT carries the bsd resistance gene for selection with the antibiotic Blasticidin, a potent selection agent that can be used at very low concentrations and in any strain regardless of auxotrophic marker.



pYES3/CT Sequence

LOCUS       Exported                5870 bp ds-DNA     circular SYN 29-NOV-2013

DEFINITION  High-copy episomal vector with a TRP1 marker for galactose-inducible

            expression of C-terminally tagged proteins in S. cerevisiae.




SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5870)

  AUTHORS   Invitrogen (Life Technologies)

  TITLE     Direct Submission

  JOURNAL   Exported Sunday, September 11, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..5870

                     /organism="synthetic DNA construct"

                     /lab_host="Saccharomyces cerevisiae"

                     /mol_type="other DNA"

     promoter        2..443

                     /gene="S. cerevisiae GAL1"

                     /note="GAL1 promoter"

                     /note="inducible promoter, regulated by Gal4"

     protein_bind    2..119



                     /note="upstream activating sequence mediating 

                     Gal4-dependent induction"

     promoter        475..493

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     misc_feature    501..600


                     /note="multiple cloning site"

     CDS             607..648


                     /product="epitope tag from simian virus 5"

                     /note="V5 tag"


     CDS             658..675


                     /product="6xHis affinity tag"



     terminator      709..956

                     /gene="S. cerevisiae CYC1"

                     /note="CYC1 terminator"

                     /note="transcription terminator for CYC1"

     rep_origin      complement(1204..1792)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(1963..2823)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(2824..2928)


                     /note="AmpR promoter"

     promoter        3031..3132

                     /gene="S. cerevisiae TRP1"

                     /note="TRP1 promoter"

     CDS             3133..3807


                     /gene="S. cerevisiae TRP1"

                     /product="phosphoribosylanthranilate isomerase, required 

                     for tryptophan biosynthesis"


                     /note="yeast auxotrophic marker"






     rep_origin      4449..5329

                     /note="2u ori"

                     /note="yeast 2u plasmid origin of replication"

     rep_origin      complement(5398..5853)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"


        1 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt

       61 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga

      121 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac

      181 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga

      241 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat

      301 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc

      361 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac

      421 ctctatactt taacgtcaag gagaaaaaac cccggatcgg actactagca gctgtaatac

      481 gactcactat agggaatatt aagcttggta ccgagctcgg atccactagt aacggccgcc

      541 agtgtgctgg aattctgcag atatccagca cagtggcggc cgctcgagtc tagagggccc

      601 ttcgaaggta agcctatccc taaccctctc ctcggtctcg attctacgcg taccggtcat

      661 catcaccatc accattgagt ttaaacccgc tgatcctaga gggccgcatc atgtaattag

      721 ttatgtcacg cttacattca cgccctcccc ccacatccgc tctaaccgaa aaggaaggag

      781 ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa

      841 cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca

      901 ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaaggcttta atttgcaagc

      961 tgcggccctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg

     1021 ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt

     1081 atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa

     1141 gaacatgtga gcaaaaggcc agcaaaagcc caggaaccgt aaaaaggccg cgttgctggc

     1201 gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag

     1261 gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt

     1321 gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg

     1381 aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg

     1441 ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg

     1501 taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac

     1561 tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg

     1621 gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt

     1681 taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg

     1741 tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc

     1801 tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt

     1861 ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt

     1921 taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag

     1981 tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt

     2041 cgtgtagata actacgatac gggagcgctt accatctggc cccagtgctg caatgatacc

     2101 gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc

     2161 cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg

     2221 ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac

     2281 aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg

     2341 atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc

     2401 tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact

     2461 gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc

     2521 aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaac

     2581 acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc

     2641 ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac

     2701 tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa

     2761 aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact

     2821 catactcttc ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg

     2881 atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg

     2941 aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct ataaaaatag

     3001 gcgtatcacg aggccctttc gtcttcaaga aattcggtcg aaaaaagaaa aggagagggc

     3061 caagagggag ggcattggtg actattgagc acgtgagtat acgtgattaa gcacacaaag

     3121 gcagcttgga gtatgtctgt tattaatttc acaggtagtt ctggtccatt ggtgaaagtt

     3181 tgcggcttgc agagcacaga ggccgcagaa tgtgctctag attccgatgc tgacttgctg

     3241 ggtattatat gtgtgcccaa tagaaagaga acaattgacc cggttattgc aaggaaaatt

     3301 tcaagtcttg taaaagcata taaaaatagt tcaggcactc cgaaatactt ggttggcgtg

     3361 tttcgtaatc aacctaagga ggatgttttg gctctggtca atgattacgg cattgatatc

     3421 gtccaactgc acggagatga gtcgtggcaa gaataccaag agttcctcgg tttgccagtt

     3481 attaaaagac tcgtatttcc aaaagactgc aacatactac tcagtgcagc ttcacagaaa

     3541 cctcattcgt ttattccctt gtttgattca gaagcaggtg ggacaggtga acttttggat

     3601 tggaactcga tttctgactg ggttggaagg caagagagcc ccgagagctt acattttatg

     3661 ttagctggtg gactgacgcc agaaaatgtt ggtgatgcgc ttagattaaa tggcgttatt

     3721 ggtgttgatg taagcggagg tgtggagaca aatggtgtaa aagactctaa caaaatagca

     3781 aatttcgtca aaaatgctaa gaaataggtt attactgagt agtatttatt taagtattgt

     3841 ttgtgcactt gccctagctt atcgatgata agctgtcaaa gatgagaatt aattccacgg

     3901 actatagact atactagata ctccgtctac tgtacgatac acttccgctc aggtccttgt

     3961 cctttaacga ggccttacca ctcttttgtt actctattga tccagctcag caaaggcagt

     4021 gtgatctaag attctatctt cgcgatgtag taaaactagc tagaccgaga aagagactag

     4081 aaatgcaaaa ggcacttcta caatggctgc catcattatt atccgatgtg acgctgcagc

     4141 ttctcaatga tattcgaata cgctttgagg agatacagcc taatatccga caaactgttt

     4201 tacagattta cgatcgtact tgttacccat cattgaattt tgaacatccg aacctgggag

     4261 ttttccctga aacagatagt atatttgaac ctgtataata atatatagtc tagcgcttta

     4321 cggaagacaa tgtatgtatt tcggttcctg gagaaactat tgcatctatt gcataggtaa

     4381 tcttgcacgt cgcatccccg gttcattttc tgcgtttcca tcttgcactt caatagcata

     4441 tctttgttaa cgaagcatct gtgcttcatt ttgtagaaca aaaatgcaac gcgagagcgc

     4501 taatttttca aacaaagaat ctgagctgca tttttacaga acagaaatgc aacgcgaaag

     4561 cgctatttta ccaacgaaga atctgtgctt catttttgta aaacaaaaat gcaacgcgac

     4621 gagagcgcta atttttcaaa caaagaatct gagctgcatt tttacagaac agaaatgcaa

     4681 cgcgagagcg ctattttacc aacaaagaat ctatacttct tttttgttct acaaaaatgc

     4741 atcccgagag cgctattttt ctaacaaagc atcttagatt actttttttc tcctttgtgc

     4801 gctctataat gcagtctctt gataactttt tgcactgtag gtccgttaag gttagaagaa

     4861 ggctactttg gtgtctattt tctcttccat aaaaaaagcc tgactccact tcccgcgttt

     4921 actgattact agcgaagctg cgggtgcatt ttttcaagat aaaggcatcc ccgattatat

     4981 tctataccga tgtggattgc gcatactttg tgaacagaaa gtgatagcgt tgatgattct

     5041 tcattggtca gaaaattatg aacggtttct tctattttgt ctctatatac tacgtatagg

     5101 aaatgtttac attttcgtat tgttttcgat tcactctatg aatagttctt actacaattt

     5161 ttttgtctaa agagtaatac tagagataaa cataaaaaat gtagaggtcg agtttagatg

     5221 caagttcaag gagcgaaagg tggatgggta ggttatatag ggatatagca cagagatata

     5281 tagcaaagag atacttttga gcaatgtttg tggaagcggt attcgcaatg ggaagctcca

     5341 ccccggttga taatcagaaa agccccaaaa acaggaagat tgtataagca aatatttaaa

     5401 ttgtaaacgt taatattttg ttaaaattcg cgttaaattt ttgttaaatc agctcatttt

     5461 ttaacgaata gcccgaaatc ggcaaaatcc cttataaatc aaaagaatag accgagatag

     5521 ggttgagtgt tgttccagtt tccaacaaga gtccactatt aaagaacgtg gactccaacg

     5581 tcaaagggcg aaaaagggtc tatcagggcg atggcccact acgtgaacca tcaccctaat

     5641 caagtttttt ggggtcgagg tgccgtaaag cagtaaatcg gaagggtaaa cggatgcccc

     5701 catttagagc ttgacgggga aagccggcga acgtggcgag aaaggaaggg aagaaagcga

     5761 aaggagcggg ggctagggcg gtgggaagtg taggggtcac gctgggcgta accaccacac

     5821 ccgccgcgct taatggggcg ctacagggcg cgtggggatg atccactagt



1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
