
  • Model: PVT11237
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11237
Packing 2ug


pYES3/CT Information

Function yeast expression plasmid

Promoter: T7, GAL1, TRP1

Replicator: 2 ori, ori, FI ori

Terminator: CYC1

Plasmid classification: yeast series, Saccharomyces cerevisiae expression vector

Plasmid size: 5870bp

Prokaryotic resistance: Amp

Screening markers: TRP1

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Induction method: galactose induction

5'sequencing primers: GAL1-F: ATTTTCGGTTTGTATTACTTC



pYES3/CT Description

pYES3/CT and pYES6/CT are S. cerevisiae expression vectors derived from the parental pYES2 vector. Vectors feature a C-terminal V5 epitope for detection with an Anti-V5 Antibody. pYES3/CT carries the TRP1 selection marker for selection in yeast. pYES6/CT carries the bsd resistance gene for selection with the antibiotic Blasticidin, a potent selection agent that can be used at very low concentrations and in any strain regardless of auxotrophic marker.



pYES3/CT Sequence

LOCUS       Exported                5870 bp ds-DNA     circular SYN 29-NOV-2013
DEFINITION  High-copy episomal vector with a TRP1 marker for galactose-inducible
            expression of C-terminally tagged proteins in S. cerevisiae.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5870)
  AUTHORS   Invitrogen (Life Technologies)
  TITLE     Direct Submission
  JOURNAL   Exported Sunday, September 11, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5870
                     /organism="synthetic DNA construct"
                     /lab_host="Saccharomyces cerevisiae"
                     /mol_type="other DNA"
     promoter        2..443
                     /gene="S. cerevisiae GAL1"
                     /note="GAL1 promoter"
                     /note="inducible promoter, regulated by Gal4"
     protein_bind    2..119
                     /note="upstream activating sequence mediating 
                     Gal4-dependent induction"
     promoter        475..493
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     misc_feature    501..600
                     /note="multiple cloning site"
     CDS             607..648
                     /product="epitope tag from simian virus 5"
                     /note="V5 tag"
     CDS             658..675
                     /product="6xHis affinity tag"
     terminator      709..956
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(1204..1792)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(1963..2823)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(2824..2928)
                     /note="AmpR promoter"
     promoter        3031..3132
                     /gene="S. cerevisiae TRP1"
                     /note="TRP1 promoter"
     CDS             3133..3807
                     /gene="S. cerevisiae TRP1"
                     /product="phosphoribosylanthranilate isomerase, required 
                     for tryptophan biosynthesis"
                     /note="yeast auxotrophic marker"
     rep_origin      4449..5329
                     /note="2u ori"
                     /note="yeast 2u plasmid origin of replication"
     rep_origin      complement(5398..5853)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
        1 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt
       61 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga
      121 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac
      181 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga
      241 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat
      301 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc
      361 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac
      421 ctctatactt taacgtcaag gagaaaaaac cccggatcgg actactagca gctgtaatac
      481 gactcactat agggaatatt aagcttggta ccgagctcgg atccactagt aacggccgcc
      541 agtgtgctgg aattctgcag atatccagca cagtggcggc cgctcgagtc tagagggccc
      601 ttcgaaggta agcctatccc taaccctctc ctcggtctcg attctacgcg taccggtcat
      661 catcaccatc accattgagt ttaaacccgc tgatcctaga gggccgcatc atgtaattag
      721 ttatgtcacg cttacattca cgccctcccc ccacatccgc tctaaccgaa aaggaaggag
      781 ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa
      841 cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca
      901 ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaaggcttta atttgcaagc
      961 tgcggccctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg
     1021 ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt
     1081 atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
     1141 gaacatgtga gcaaaaggcc agcaaaagcc caggaaccgt aaaaaggccg cgttgctggc
     1201 gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
     1261 gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt
     1321 gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg
     1381 aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg
     1441 ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
     1501 taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac
     1561 tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct tgaag
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
