pYES6- CT

$215.00

  • Model: PVT11238
  • 49 Units in Stock
Ask a question


Add to Cart:

pYES6-CT

PVT11238          2ug

 

pYES6-CT Information

Prokaryotic resistance Amp

Screening marker: Blast

Clonal strain: DH5a

The culture condition:37 ℃

Vector host: Yeast

Carrier usage: Protein expression

Gene species:-

Gene type:-

Prokaryotic resistance Amp

Eukaryotic resistance Blast

 

pYES6-CT Description

pYES6-CT is a 5.8 KB vector designed to induce the expression of recombinant protein in Saccharomyces cerevisiae.

The carrier contains the following elements:

1. Yeast GAL1 promoter can be induced by high level of galactose to express the target protein in Saccharomyces cerevisiae and inhibited by glucose

2. 10 restriction sites and two BstX I restriction sites can be used for gene insertion.

3. Ampicillin resistance gene can be easily screened in E. coli.

4. The blast icidin resistance gene can be easily screened in Escherichia coli and yeast.

5. The C-terminal of the vector encodes the epitope of V5 antigen and his purification tag, which is convenient for protein purification and Western blot detection.

6. In yeast, 2 μ The replicon maintains a high copy of the plasmid

 

pYES6-CT Sequence

ACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTC
ACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATA
CTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAAT
CAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGA
AGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTT
CAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATAC
CTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCGGACTACTAGCAGCTGTAATACGACTCACTAT
AGGGAATATTAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCTGCAG
ATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCTTCGAAGGTAAGCCTATCCCTAACCCTCTC
CTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTAAACCCGCTGATCCTAGA
GGGCCGCATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGAA
AAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAA
CGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAA
AACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCAAGCTGCGGCCCTGCATTAATGAA
TCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCT
GCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAA
TCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGCCCAGGAACCGTAAAAAGGCCG
CGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAG
GTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCT
GTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATA
GCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCC
CGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTA
TCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCT
TGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT
TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTT
GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGT
CTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCAC
CTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGAC
AGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCT
GACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACC
GCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA
AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTT
CGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGG
TATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAA
GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTA
TGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC
AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAAT
ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAA
GGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT
TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCG
ACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATGGGTAATAACTGATATAATTAAATTGAAGC
TCTAATTTGTGAGTTTAGTAGACATGCAGATCTCCCGGGACGTGTCAGTCCTGCTCCTCGGCCACGAAGT
GCTTAGCCCTCCCACACATAACCAGAGGGCAGCAATTCACGAATCCCAACTGCCGTCGGCTGTCCATCAC
TGTCCTTCACTATGGCTTTGATCCCAGGATGCAGATCGAGAAGAACCTGTCGGCACCGTCCGCAGGGCTC
AAGATGCCCCTGTTCTCATTTCCGATCGCGACGATACAAGTCAGGTTGCCAGCTGCCGCAGCAGCAGCAG
TGCCCAGCACCACGAGTTCTGCGCAAGGTCCCCCAGTAAAATGATATACATTGACACCAGTGAAGATGCG
GCCGTCGCTAGAGAGAGCTGCGCTGGCGACGCTGTAGTCTTCAGAGATGGGGATGCTGTTGATTGTAGCC
GTTGCTCTTTCAATGAGGGTGGATTCTTCTTGAGACAAAGGCTTGGCCATGGTTTAGTTCCTCACCTTGT
CGTATTATACTATGCCGATATACTATGCCGATGATTAATTGTCAACACCGCCCTTAGATTAGATTGCTAT
GCTTTCTTTCTAATGAGCAAGAAGTAAAAAAAGTTGTAATAGAACAAGAAAAATGAAACTGAAACTTGAG
AAATTGAAGACCGTTTATTAACTTAAATATCAATGGGAGGTCATCGAAAGAGAAAAAAATCAAAAAAAAA
AATTTTCAAGAAAAAGAAACGTGATAAAAATTTTTATTGCCTTTTTCGACGAAGAAAAAGAAACGAGGCG
GTCTCTTTTTTCTTTTCCAAACCTTTAGTACGGGTAATTAACGACACCCTAGAGGAAGAAAGAGGGGAAA
TTTAGTATGCTGTGCTTGGGTGTTTTGAAGTGGTACGGCGATGCGCGGAGTCCGAGAAAATCTGGAAGAG
TAAAAAAGGAGTAGAAACATTTTGAAGCTATGGTGTGTGGGGCTAGCTTATCGATGATAAGCTGTCAAAG
ATGAGAATTAATTCCACGGACTATAGACTATACTAGATACTCCGTCTACTGTACGATACACTTCCGCTCA
GGTCCTTGTCCTTTAACGAGGCCTTACCACTCTTTTGTTACTCTATTGATCCAGCTCAGCAAAGGCAGTG
TGATCTAAGATTCTATCTTCGCGATGTAGTAAAACTAGCTAGACCGAGAAAGAGACTAGAAATGCAAAAG
GCACTTCTACAATGGCTGCCATCATTATTATCCGATGTGACGCTGCAGCTTCTCAATGATATTCGAATAC
GCTTTGAGGAGATACAGCCTAATATCCGACAAACTGTTTTACAGATTTACGATCGTACTTGTTACCCATC
ATTGAATTTTGAACATCCGAACCTGGGAGTTTTCCCTGAAACAGATAGTATATTTGAACCTGTATAATAA
TATATAGTCTAGCGCTTTACGGAAGACAATGTATGTATTTCGGTTCCTGGAGAAACTATTGCATCTATTG
CATAGGTAATCTTGCACGTCGCATCCCCGGTTCATTTTCTGCGTTTCCATCTTGCACTTCAATAGCATAT
CTTTGTTAACGAAGCATCTGTGCTTCATTTTGTAGAACAAAAATGCAACGCGAGAGCGCTAATTTTTCAA
ACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGCGAAAGCGCTATTTTACCAACGAAGAA
TCTGTGCTTCATTTTTGTAAAACAAAAATGCAACGCGACGAGAGCGCTAATTTTTCAAACAAAGAATCTG
AGCTGCATTTTTACAGAACAGAAATGCAACGCGAGAGCGCTATTTTACCAACAAAGAATCTATACTTCTT
TTTTGTTCTACAAAAATGCATCCCGAGAGCGCTATTTTTCTAACAAAGCATCTTAGATTACTTTTTTTCT
CCTTTGTGCGCTCTATAATGCAGTCTCTTGATAACTTTTTGCACTGTAGGTCCGTTAAGGTTAGAAGAAG
GCTACTTTGGTGTCTATTTTCTCTTCCATAAAAAAAGCCTGACTCCACTTCCCGCGTTTACTGATTACTA
GCGAAGCTGCGGGTGCATTTTTTCAAGATAAAGGCATCCCCGATTATATTCTATACCGATGTGGATTGCG
CATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTATGAACGGTTTCTT
CTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTATGA
ATAGTTCTTACTACAATTTTTTTGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGA
GTTTAGATGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATAT
AGCAAAGAGATACTTTTGAGCAATGTTTGTGGAAGCGGTATTCGCAATGGGAAGCTCCACCCCGGTTGAT
AATCAGAAAAGCCCCAAAAACAGGAAGATTGTATAAGCAAATATTTAAATTGTAAACGTTAATATTTTGT
TAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACGAATAGCCCGAAATCGGCAAAATCCC
TTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTCCAACAAGAGTCCACTATTA
AAGAACGTGGACTCCAACGTCAAAGGGCGAAAAAGGGTCTATCAGGGCGATGGCCCACTACGTGAACCAT
CACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCAGTAAATCGGAAGGGTAAACGGATGCCCCC
ATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGG
GCTAGGGCGGTGGGAAGTGTAGGGGTCACGCTGGGCGTAACCACCACACCCGCCGCGCTTAATGGGGCGC
TACAGGGCGCGTGGGGATGATCCACTAGT

//

 

 

Caution:
1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart