pYM30- ECFP Plasmid


  • Model: PVT4014
  • 50 Units in Stock
Ask a question

Add to Cart:

pYM30-ECFP Plasmid

PVT4014     2ug


pYM30-ECFP Plasmid Information

Promoter: TEF

Replicator: ori

Terminator: Adh1

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid size: 4946bp

Plasmid label: ECFP

Prokaryotic resistance: Amp

Clone strain: DH5a

Culture condition: 37℃

Expression host: yeast cell

5 'sequencing primer: T7: taatacgactcactataggg

3'sequencing primers: primers designed according to the sequence

Plasmid host: yeast

Purpose of plasmid: protein expression

Clip type:-

Fragment species:-

Prokaryotic resistance: amp

Eukaryotic resistance:-

Fluorescent labeling: -


pYM30-ECFP Plasmid Description


pYM30-ECFP Plasmid Sequence

LOCUS       Exported                4946 bp ds-DNA     circular SYN 19-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 8

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4946)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, September 19, 2016 from SnapGene Viewer 3.2.1

FEATURES             Location/Qualifiers

     source          1..4946

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             79..795


                     /product="enhanced CFP"


                     /note="mammalian codon-optimized"






     CDS             802..828


                     /product="HA (human influenza hemagglutinin) epitope tag"



     terminator      861..1048

                     /gene="S. cerevisiae ADH1"

                     /note="ADH1 terminator"

                     /note="transcription terminator for the S. cerevisiae 

                     alcohol dehydrogenase 1 (ADH1) gene"

     gene            1123..2479


                     /note="yeast selectable marker conferring kanamycin 

                     resistance (Wach et al., 1994)"

     promoter        1123..1466

                     /note="TEF promoter"

                     /note="Ashbya gossypii TEF promoter"

     CDS             1467..2276



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin"






     terminator      2282..2479

                     /note="TEF terminator"

                     /note="Ashbya gossypii TEF terminator"

     promoter        complement(2584..2602)

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     rep_origin      complement(2860..3448)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(3619..4479)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(4480..4584)


                     /note="AmpR promoter"

     promoter        4930..2

                     /note="SP6 promoter"

                     /note="promoter for bacteriophage SP6 RNA polymerase"


        1 gaacgcggcc gccagctgaa gcttcgtacg ctgcaggtcg acggatccgg agcaggtgct

       61 ggtgctggtg ctggagcaat gagcaagggc gaggagctgt tcaccggggt ggtgcccatc

      121 ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgtccgg cgagggcgag

      181 ggcgatgcca cctacggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc

      241 gtgccctggc ccaccctcgt gaccaccctg acctggggcg tgcagtgctt cagccgctac

      301 cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacgtccag

      361 gagcgcacca tcttcttcaa ggacgacggc aactacaaga cccgcgccga ggtgaagttc

      421 gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc

      481 aacatcctgg ggcacaagct ggagtacaac tacatcagcc acaacgtcta tatcaccgcc

      541 gacaagcaga agaacggcat caaggccaac ttcaagatcc gccacaacat cgaggacggc

      601 agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg ccccgtgctg

      661 ctgcccgaca accactacct gagcacccag tccgccctga gcaaagaccc caacgagaag

      721 cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct cggcatggac

      781 gagctgtaca agtaaggatc ctatccatat gacgttccag attacgctgc tcagtgctag

      841 ggcgcgccac ttctaaataa gcgaatttct tatgatttat gatttttatt attaaataag

      901 ttataaaaaa aataagtgta tacaaatttt aaagtgactc ttaggtttta aaacgaaaat

      961 tcttattctt gagtaactct ttcctgtagg tcaggttgct ttctcaggta tagtatgagg

     1021 tcgctcttat tgaccacacc tctaccggca gatccgctag ggataacagg gtaatataga

     1081 tctgtttagc ttgcctcgtc cccgccgggt cacccggcca gcgacatgga ggcccagaat

     1141 accctccttg acagtcttga cgtgcgcagc tcaggggcat gatgtgactg tcgcccgtac

     1201 atttagccca tacatcccca tgtataatca tttgcatcca tacattttga tggccgcacg

     1261 gcgcgaagca aaaattacgg ctcctcgctg cagacctgcg agcagggaaa cgctcccctc

     1321 acagacgcgt tgaattgtcc ccacgccgcg cccctgtaga gaaatataaa aggttaggat

     1381 ttgccactga ggttcttctt tcatatactt ccttttaaaa tcttgctagg atacagttct

     1441 cacatcacat ccgaacataa acaaccatgg gtaaggaaaa gactcacgtt tcgaggccgc

     1501 gattaaattc caacatggat gctgatttat atgggtataa atgggctcgc gataatgtcg

     1561 ggcaatcagg tgcgacaatc tatcgattgt atgggaagcc cgatgcgcca gagttgtttc

     1621 tgaaacatgg caaaggtagc gttgccaatg atgttacaga tgagatggtc agactaaact

     1681 ggctgacgga atttatgcct cttccgacca tcaagcattt tatccgtact cctgatgatg

     1741 catggttact caccactgcg atccccggca aaacagcatt ccaggtatta gaagaatatc

     1801 ctgattcagg tgaaaatatt gttgatgcgc tggcagtgtt cctgcgccgg ttgcattcga

     1861 ttcctgtttg taattgtcct tttaacagcg atcgcgtatt tcgtctcgct caggcgcaat

     1921 cacgaatgaa taacggtttg gttgatgcga gtgattttga tgacgagcgt aatggctggc

     1981 ctgttgaaca agtctggaaa gaaatgcata agcttttgcc attctcaccg gattcagtcg

     2041 tcactcatgg tgatttctca cttgataacc ttatttttga cgaggggaaa ttaataggtt

     2101 gtattgatgt tggacgagtc ggaatcgcag accgatacca ggatcttgcc atcctatgga

     2161 actgcctcgg tgagttttct ccttcattac agaaacggct ttttcaaaaa tatggtattg

     2221 ataatcctga tatgaataaa ttgcagtttc atttgatgct cgatgagttt ttctaatcag

     2281 tactgacaat aaaaagattc ttgttttcaa gaacttgtca tttgtatagt ttttttatat

     2341 tgtagttgtt ctattttaat caaatgttag cgtgatttat attttttttc gcctcgacat

     2401 catctgccca gatgcgaagt taagtgcgca gaaagtaata tcatgcgtca atcgtatgtg

     2461 aatgctggtc gctatactgc tgtcgattcg atactaacgc cgccatccag tttaaacgag

     2521 ctcgaattca tcgatgatat cagatccact agtggcctat gcggccgcgg atctgccggt

     2581 ctccctatag tgagtcgtat taatttcgat aagccaggtt aacctgcatt aatgaatcgg

     2641 ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga

     2701 ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat

     2761 acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca

     2821 aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc

     2881 tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata

     2941 aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc

     3001 gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc

     3061 acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga

     3121 accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc

     3181 ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag

     3241 gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag

     3301 gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag

     3361 ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca

     3421 gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga

     3481 cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat

     3541 cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga

     3601 gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg

     3661 tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga

     3721 gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc

     3781 agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac

     3841 tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc

     3901 agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc

     3961 gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc

     4021 catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt

     4081 ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc

     4141 atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg

     4201 tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag

     4261 cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat

     4321 cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc

     4381 atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa

     4441 aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta

     4501 ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa

     4561 aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga

     4621 aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtct

     4681 cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac

     4741 agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt

     4801 tggcgggtgt cggggctggc ttaactatgc ggcatcagag cagattgtac tgagagtgca

     4861 ccatatggac atattgtcgt tagaacgcgg ctacaattaa tacataacct tatgtatcat

     4921 acacatacga tttaggtgac actata


Search name

pYM30-ECFP,Plasmid pYM30-ECFP,pYM30-ECFP vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
